EMAIL THIS PAGE TO A FRIEND

ATP6V1D

ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D

54 Gene Product Result for
Synonyms: ATP6M VATD VMA8
UniProtKB ID: Q9Y5K8, B2RE33, Q9Y688
Gene ID:
Human(51382) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes the V1 domain D subunit protein. [provided by RefSeq, Jul 2008]
Mouse(73834) ATPase, H+ transporting, lysosomal V1 subunit D
Rat(299159) ATPase, H+ transporting, lysosomal V1 subunit D
sheep(101121176) ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
Domestic Rabbit(100009221) ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
domestic guinea pig(100716088) ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
naked mole-rat(101723759) ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
Zebrafish(393935) ATPase, H+ transporting, V1 subunit D
dog(480360) ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
domestic cat(101091205) ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
cow(404152) ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
chicken(423280) ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015994 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015994 Rosetta Predictions human pricing
NM_199386 Rosetta Predictions rat pricing
NM_023721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023510 predicted 928
2 SASI_Hs02_00348674 predicted 899
3 SASI_Hs01_00023512 predicted 872
4 SASI_Hs02_00348675 predicted 561
5 SASI_Hs01_00023514 predicted 481
6 SASI_Hs01_00023515 predicted 984
7 SASI_Hs01_00023516 predicted 598
8 SASI_Hs01_00023517 predicted 709
9 SASI_Hs01_00023518 predicted 683
10 SASI_Hs01_00023519 predicted 614
11 SASI_Hs01_00023511 predicted 222
12 SASI_Hs01_00023513 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092455 predicted 669
2 SASI_Rn01_00092456 predicted 868
3 SASI_Rn01_00092457 predicted 240
4 SASI_Rn01_00092458 predicted 382
5 SASI_Rn01_00092459 predicted 477
6 SASI_Rn01_00092460 predicted 425
7 SASI_Rn01_00092461 predicted 902
8 SASI_Rn02_00270205 predicted 431
9 SASI_Rn02_00270206 predicted 662
10 SASI_Rn02_00270207 predicted 390
11 SASI_Rn01_00092462 predicted 582
12 SASI_Rn01_00092463 predicted 314
13 SASI_Rn01_00092464 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075614 predicted 470
2 SASI_Mm01_00075615 predicted 224
3 SASI_Mm01_00075616 predicted 281
4 SASI_Mm01_00075617 predicted 577
5 SASI_Mm01_00075618 predicted 680
6 SASI_Mm01_00075619 predicted 485
7 SASI_Mm01_00075620 predicted 570
8 SASI_Mm01_00075621 predicted 964
9 SASI_Mm01_00075622 predicted 191
10 SASI_Mm02_00327306 predicted 532
11 SASI_Mm01_00075613 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023721
VALIDATED
ATP6V1D MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023721.2-229s21c1
Sequence:CCGGCCATCATGAAGGCTCGATTAACTCGAGTTAATCGAGCCTTCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023721.2-1102s21c1
Sequence:CCGGGCCCAGCAACCTACAGAATTTCTCGAGAAATTCTGTAGGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023721.2-765s21c1
Sequence:CCGGCGAGAAGAATTCTATAGGTTACTCGAGTAACCTATAGAATTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023721.2-681s21c1
Sequence:CCGGCGTGTTAATGCCATTGAGCATCTCGAGATGCTCAATGGCATTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-923s1c1
Sequence:CCGGGCCCAGCAACCTACAGAATTTCTCGAGAAATTCTGTAGGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-586s1c1
Sequence:CCGGCGAGAAGAATTCTATAGGTTACTCGAGTAACCTATAGAATTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-50s1c1
Sequence:CCGGCCATCATGAAGGCTCGATTAACTCGAGTTAATCGAGCCTTCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-502s1c1
Sequence:CCGGCGTGTTAATGCCATTGAGCATCTCGAGATGCTCAATGGCATTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023721.1-394s1c1
Sequence:CCGGGCTAAACTAAAGCGGAATTATCTCGAGATAATTCCGCTTTAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023721
VALIDATED
ATP6V1D MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023721.2-229s21c1
Sequence:CCGGCCATCATGAAGGCTCGATTAACTCGAGTTAATCGAGCCTTCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023721.2-1102s21c1
Sequence:CCGGGCCCAGCAACCTACAGAATTTCTCGAGAAATTCTGTAGGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023721.2-765s21c1
Sequence:CCGGCGAGAAGAATTCTATAGGTTACTCGAGTAACCTATAGAATTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023721.2-681s21c1
Sequence:CCGGCGTGTTAATGCCATTGAGCATCTCGAGATGCTCAATGGCATTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-923s1c1
Sequence:CCGGGCCCAGCAACCTACAGAATTTCTCGAGAAATTCTGTAGGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-586s1c1
Sequence:CCGGCGAGAAGAATTCTATAGGTTACTCGAGTAACCTATAGAATTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-50s1c1
Sequence:CCGGCCATCATGAAGGCTCGATTAACTCGAGTTAATCGAGCCTTCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-502s1c1
Sequence:CCGGCGTGTTAATGCCATTGAGCATCTCGAGATGCTCAATGGCATTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023721.1-394s1c1
Sequence:CCGGGCTAAACTAAAGCGGAATTATCTCGAGATAATTCCGCTTTAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023721
VALIDATED
ATP6V1D MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023721.2-229s21c1
Sequence:CCGGCCATCATGAAGGCTCGATTAACTCGAGTTAATCGAGCCTTCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023721.2-1102s21c1
Sequence:CCGGGCCCAGCAACCTACAGAATTTCTCGAGAAATTCTGTAGGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023721.2-765s21c1
Sequence:CCGGCGAGAAGAATTCTATAGGTTACTCGAGTAACCTATAGAATTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023721.2-681s21c1
Sequence:CCGGCGTGTTAATGCCATTGAGCATCTCGAGATGCTCAATGGCATTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-923s1c1
Sequence:CCGGGCCCAGCAACCTACAGAATTTCTCGAGAAATTCTGTAGGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-586s1c1
Sequence:CCGGCGAGAAGAATTCTATAGGTTACTCGAGTAACCTATAGAATTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-50s1c1
Sequence:CCGGCCATCATGAAGGCTCGATTAACTCGAGTTAATCGAGCCTTCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023721.1-502s1c1
Sequence:CCGGCGTGTTAATGCCATTGAGCATCTCGAGATGCTCAATGGCATTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023721.1-394s1c1
Sequence:CCGGGCTAAACTAAAGCGGAATTATCTCGAGATAATTCCGCTTTAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015994
VALIDATED
ATP6V1D MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-480s21c1
Sequence:CCGGGCAGGTGTTACTTTGCCAGTACTCGAGTACTGGCAAAGTAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-309s21c1
Sequence:CCGGCGACAGATCCTAAAGAAGATACTCGAGTATCTTCTTTAGGATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-687s21c1
Sequence:CCGGGCCATTGAACATGTCATCATTCTCGAGAATGATGACATGTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-870s21c1
Sequence:CCGGCCTGCTAATCTTCTGGCTGAACTCGAGTTCAGCCAGAAGATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-446s21c1
Sequence:CCGGGCAAGTGAAGATTCGAGCGAACTCGAGTTCGCTCGAATCTTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-480s1c1
Sequence:CCGGGCAGGTGTTACTTTGCCAGTACTCGAGTACTGGCAAAGTAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-687s1c1
Sequence:CCGGGCCATTGAACATGTCATCATTCTCGAGAATGATGACATGTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-446s1c1
Sequence:CCGGGCAAGTGAAGATTCGAGCGAACTCGAGTTCGCTCGAATCTTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015994.2-309s1c1
Sequence:CCGGCGACAGATCCTAAAGAAGATACTCGAGTATCTTCTTTAGGATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-870s1c1
Sequence:CCGGCCTGCTAATCTTCTGGCTGAACTCGAGTTCAGCCAGAAGATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015994
VALIDATED
ATP6V1D MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-480s21c1
Sequence:CCGGGCAGGTGTTACTTTGCCAGTACTCGAGTACTGGCAAAGTAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-309s21c1
Sequence:CCGGCGACAGATCCTAAAGAAGATACTCGAGTATCTTCTTTAGGATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-687s21c1
Sequence:CCGGGCCATTGAACATGTCATCATTCTCGAGAATGATGACATGTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-870s21c1
Sequence:CCGGCCTGCTAATCTTCTGGCTGAACTCGAGTTCAGCCAGAAGATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-446s21c1
Sequence:CCGGGCAAGTGAAGATTCGAGCGAACTCGAGTTCGCTCGAATCTTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-480s1c1
Sequence:CCGGGCAGGTGTTACTTTGCCAGTACTCGAGTACTGGCAAAGTAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-687s1c1
Sequence:CCGGGCCATTGAACATGTCATCATTCTCGAGAATGATGACATGTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-446s1c1
Sequence:CCGGGCAAGTGAAGATTCGAGCGAACTCGAGTTCGCTCGAATCTTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015994.2-309s1c1
Sequence:CCGGCGACAGATCCTAAAGAAGATACTCGAGTATCTTCTTTAGGATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-870s1c1
Sequence:CCGGCCTGCTAATCTTCTGGCTGAACTCGAGTTCAGCCAGAAGATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015994
VALIDATED
ATP6V1D MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-480s21c1
Sequence:CCGGGCAGGTGTTACTTTGCCAGTACTCGAGTACTGGCAAAGTAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-309s21c1
Sequence:CCGGCGACAGATCCTAAAGAAGATACTCGAGTATCTTCTTTAGGATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-687s21c1
Sequence:CCGGGCCATTGAACATGTCATCATTCTCGAGAATGATGACATGTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-870s21c1
Sequence:CCGGCCTGCTAATCTTCTGGCTGAACTCGAGTTCAGCCAGAAGATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015994.2-446s21c1
Sequence:CCGGGCAAGTGAAGATTCGAGCGAACTCGAGTTCGCTCGAATCTTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-480s1c1
Sequence:CCGGGCAGGTGTTACTTTGCCAGTACTCGAGTACTGGCAAAGTAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-687s1c1
Sequence:CCGGGCCATTGAACATGTCATCATTCTCGAGAATGATGACATGTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-446s1c1
Sequence:CCGGGCAAGTGAAGATTCGAGCGAACTCGAGTTCGCTCGAATCTTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015994.2-309s1c1
Sequence:CCGGCGACAGATCCTAAAGAAGATACTCGAGTATCTTCTTTAGGATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015994.2-870s1c1
Sequence:CCGGCCTGCTAATCTTCTGGCTGAACTCGAGTTCAGCCAGAAGATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks