EMAIL THIS PAGE TO A FRIEND

ATP6V1E1

ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1

74 Gene Product Result for
Synonyms: ATP6E ATP6E2 ATP6V1E P31 Vma4
UniProtKB ID: P36543, A8MUE4, A8MUN4
Gene ID:
Human(529) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain E subunit isoforms. Pseudogenes for this gene have been found in the genome. [provided by RefSeq, Jul 2008]
Mouse(11973) ATPase, H+ transporting, lysosomal V1 subunit E1
Rat(297566) ATPase, H+ transporting, lysosomal V1 subunit E1
chicken(418162) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
Horse(100049854) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
cow(287017) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
Horse(100072896) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
domestic cat(101081815) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
dog(477740) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
naked mole-rat(101713169) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
domestic guinea pig(100725691) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
sheep(494438) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001696 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039366 Rosetta Predictions human pricing
NM_001039367 Rosetta Predictions human pricing
NM_001696 Rosetta Predictions human pricing
NM_198745 Rosetta Predictions rat pricing
NM_007510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017644 predicted 967
2 SASI_Hs01_00017645 predicted 963
3 SASI_Hs01_00017646 predicted 938
4 SASI_Hs01_00017647 predicted 850
5 SASI_Hs02_00308470 predicted 1089
6 SASI_Hs01_00017648 predicted 903
7 SASI_Hs01_00017649 predicted 1103
8 SASI_Hs01_00017650 predicted 1109
9 SASI_Hs01_00017651 predicted 834
10 SASI_Hs01_00017652 predicted 971
11 SASI_Hs01_00017653 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126234 predicted 946
2 SASI_Hs01_00126235 predicted 943
3 SASI_Hs01_00126236 predicted 916
4 SASI_Hs01_00126237 predicted 825
5 SASI_Hs02_00308471 predicted 1067
6 SASI_Hs01_00126238 predicted 881
7 SASI_Hs01_00126239 predicted 1081
8 SASI_Hs01_00126240 predicted 1081
9 SASI_Hs01_00126241 predicted 815
10 SASI_Hs01_00126242 predicted 948
11 SASI_Hs01_00126243 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018274 predicted 1037
2 SASI_Hs01_00018275 predicted 1035
3 SASI_Hs01_00018276 predicted 1002
4 SASI_Hs01_00018277 predicted 921
5 SASI_Hs02_00332363 predicted 1155
6 SASI_Hs01_00018278 predicted 966
7 SASI_Hs01_00018279 predicted 1172
8 SASI_Hs01_00018280 predicted 1169
9 SASI_Hs01_00018281 predicted 905
10 SASI_Hs01_00018282 predicted 1031
11 SASI_Hs01_00018283 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075975 predicted 825
2 SASI_Rn01_00075976 predicted 248
3 SASI_Rn01_00075977 predicted 757
4 SASI_Rn01_00075978 predicted 488
5 SASI_Rn01_00075979 predicted 473
6 SASI_Rn01_00075980 predicted 225
7 SASI_Rn01_00075981 predicted 217
8 SASI_Rn01_00075982 predicted 327
9 SASI_Rn01_00075983 predicted 517
10 SASI_Rn01_00075984 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143764 predicted 713
2 SASI_Mm01_00143765 predicted 574
3 SASI_Mm01_00143766 predicted 618
4 SASI_Mm02_00311804 predicted 489
5 SASI_Mm01_00143767 predicted 696
6 SASI_Mm01_00143768 predicted 203
7 SASI_Mm01_00143769 predicted 810
8 SASI_Mm01_00143770 predicted 328
9 SASI_Mm01_00143771 predicted 477
10 SASI_Mm01_00143772 predicted 667
11 SASI_Mm01_00143773 predicted 742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001696
VALIDATED
ATP6V1E1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001696.2-680s1c1
Sequence:CCGGGATCTATAATGGAGATCGTAACTCGAGTTACGATCTCCATTATAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001696.2-410s1c1
Sequence:CCGGAGACCTACTAAATGAAGCAAACTCGAGTTTGCTTCATTTAGTAGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001696.2-786s1c1
Sequence:CCGGGCAAATGCCAACAGGAAGTTTCTCGAGAAACTTCCTGTTGGCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001696.2-345s1c1
Sequence:CCGGCAGATGTCCAATTTGATGAATCTCGAGATTCATCAAATTGGACATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001696.2-523s1c1
Sequence:CCGGCCCGAATGATTGTTCGTTGCACTCGAGTGCAACGAACAATCATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-398s21c1
Sequence:CCGGCAGATGTCCAATTTGATGAATCTCGAGATTCATCAAATTGGACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-454s21c1
Sequence:CCGGCCTTATCACAGACCTACTAAACTCGAGTTTAGTAGGTCTGTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001696.3-1176s21c1
Sequence:CCGGTGGCCTAAAGGTGATGTATTTCTCGAGAAATACATCACCTTTAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-669s21c1
Sequence:CCGGACGATGTTGATGTCCAAATTGCTCGAGCAATTTGGACATCAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-721s21c1
Sequence:CCGGTGGTGGAGTTGAGATCTATAACTCGAGTTATAGATCTCAACTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001696
VALIDATED
ATP6V1E1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001696.2-680s1c1
Sequence:CCGGGATCTATAATGGAGATCGTAACTCGAGTTACGATCTCCATTATAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001696.2-410s1c1
Sequence:CCGGAGACCTACTAAATGAAGCAAACTCGAGTTTGCTTCATTTAGTAGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001696.2-786s1c1
Sequence:CCGGGCAAATGCCAACAGGAAGTTTCTCGAGAAACTTCCTGTTGGCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001696.2-345s1c1
Sequence:CCGGCAGATGTCCAATTTGATGAATCTCGAGATTCATCAAATTGGACATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001696.2-523s1c1
Sequence:CCGGCCCGAATGATTGTTCGTTGCACTCGAGTGCAACGAACAATCATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-398s21c1
Sequence:CCGGCAGATGTCCAATTTGATGAATCTCGAGATTCATCAAATTGGACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-454s21c1
Sequence:CCGGCCTTATCACAGACCTACTAAACTCGAGTTTAGTAGGTCTGTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001696.3-1176s21c1
Sequence:CCGGTGGCCTAAAGGTGATGTATTTCTCGAGAAATACATCACCTTTAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-669s21c1
Sequence:CCGGACGATGTTGATGTCCAAATTGCTCGAGCAATTTGGACATCAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-721s21c1
Sequence:CCGGTGGTGGAGTTGAGATCTATAACTCGAGTTATAGATCTCAACTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001696
VALIDATED
ATP6V1E1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001696.2-680s1c1
Sequence:CCGGGATCTATAATGGAGATCGTAACTCGAGTTACGATCTCCATTATAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001696.2-410s1c1
Sequence:CCGGAGACCTACTAAATGAAGCAAACTCGAGTTTGCTTCATTTAGTAGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001696.2-786s1c1
Sequence:CCGGGCAAATGCCAACAGGAAGTTTCTCGAGAAACTTCCTGTTGGCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001696.2-345s1c1
Sequence:CCGGCAGATGTCCAATTTGATGAATCTCGAGATTCATCAAATTGGACATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001696.2-523s1c1
Sequence:CCGGCCCGAATGATTGTTCGTTGCACTCGAGTGCAACGAACAATCATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-398s21c1
Sequence:CCGGCAGATGTCCAATTTGATGAATCTCGAGATTCATCAAATTGGACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-454s21c1
Sequence:CCGGCCTTATCACAGACCTACTAAACTCGAGTTTAGTAGGTCTGTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001696.3-1176s21c1
Sequence:CCGGTGGCCTAAAGGTGATGTATTTCTCGAGAAATACATCACCTTTAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-669s21c1
Sequence:CCGGACGATGTTGATGTCCAAATTGCTCGAGCAATTTGGACATCAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001696.3-721s21c1
Sequence:CCGGTGGTGGAGTTGAGATCTATAACTCGAGTTATAGATCTCAACTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007510
VALIDATED
ATP6V1E1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-806s1c1
Sequence:CCGGGCTTCCTCTTTCTGTTCTAATCTCGAGATTAGAACAGAAAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-717s1c1
Sequence:CCGGGCAAATGCCAATAGGAAGTTTCTCGAGAAACTTCCTATTGGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-332s1c1
Sequence:CCGGCCTCATCACTGATCTGCTAAACTCGAGTTTAGCAGATCAGTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-701s1c1
Sequence:CCGGTGGAGCCTTGTTTGGTGCAAACTCGAGTTTGCACCAAACAAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-204s1c1
Sequence:CCGGCAAACGCAAAGACTGAAGATTCTCGAGAATCTTCAGTCTTTGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007510.2-806s21c1
Sequence:CCGGGCTTCCTCTTTCTGTTCTAATCTCGAGATTAGAACAGAAAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007510.2-717s21c1
Sequence:CCGGGCAAATGCCAATAGGAAGTTTCTCGAGAAACTTCCTATTGGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007510.2-701s21c1
Sequence:CCGGTGGAGCCTTGTTTGGTGCAAACTCGAGTTTGCACCAAACAAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007510.2-332s21c1
Sequence:CCGGCCTCATCACTGATCTGCTAAACTCGAGTTTAGCAGATCAGTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007510
VALIDATED
ATP6V1E1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-806s1c1
Sequence:CCGGGCTTCCTCTTTCTGTTCTAATCTCGAGATTAGAACAGAAAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-717s1c1
Sequence:CCGGGCAAATGCCAATAGGAAGTTTCTCGAGAAACTTCCTATTGGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-332s1c1
Sequence:CCGGCCTCATCACTGATCTGCTAAACTCGAGTTTAGCAGATCAGTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-701s1c1
Sequence:CCGGTGGAGCCTTGTTTGGTGCAAACTCGAGTTTGCACCAAACAAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-204s1c1
Sequence:CCGGCAAACGCAAAGACTGAAGATTCTCGAGAATCTTCAGTCTTTGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007510.2-806s21c1
Sequence:CCGGGCTTCCTCTTTCTGTTCTAATCTCGAGATTAGAACAGAAAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007510.2-717s21c1
Sequence:CCGGGCAAATGCCAATAGGAAGTTTCTCGAGAAACTTCCTATTGGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007510.2-701s21c1
Sequence:CCGGTGGAGCCTTGTTTGGTGCAAACTCGAGTTTGCACCAAACAAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007510.2-332s21c1
Sequence:CCGGCCTCATCACTGATCTGCTAAACTCGAGTTTAGCAGATCAGTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007510
VALIDATED
ATP6V1E1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-806s1c1
Sequence:CCGGGCTTCCTCTTTCTGTTCTAATCTCGAGATTAGAACAGAAAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-717s1c1
Sequence:CCGGGCAAATGCCAATAGGAAGTTTCTCGAGAAACTTCCTATTGGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-332s1c1
Sequence:CCGGCCTCATCACTGATCTGCTAAACTCGAGTTTAGCAGATCAGTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-701s1c1
Sequence:CCGGTGGAGCCTTGTTTGGTGCAAACTCGAGTTTGCACCAAACAAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007510.2-204s1c1
Sequence:CCGGCAAACGCAAAGACTGAAGATTCTCGAGAATCTTCAGTCTTTGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007510.2-806s21c1
Sequence:CCGGGCTTCCTCTTTCTGTTCTAATCTCGAGATTAGAACAGAAAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007510.2-717s21c1
Sequence:CCGGGCAAATGCCAATAGGAAGTTTCTCGAGAAACTTCCTATTGGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007510.2-701s21c1
Sequence:CCGGTGGAGCCTTGTTTGGTGCAAACTCGAGTTTGCACCAAACAAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007510.2-332s21c1
Sequence:CCGGCCTCATCACTGATCTGCTAAACTCGAGTTTAGCAGATCAGTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks