EMAIL THIS PAGE TO A FRIEND

ATP6V1E2

ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2

47 Gene Product Result for
Synonyms: ATP6E1 ATP6EL2 ATP6V1EL2 VMA4
UniProtKB ID: Q96A05
Gene ID:
Mouse(74915) ATPase, H+ transporting, lysosomal V1 subunit E2
Rat(366545) ATPase, H transporting, lysosomal V1 subunit E2
dog(481359) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
domestic cat(101101208) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
cow(540113) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
sheep(101110043) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
domestic guinea pig(100722091) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
naked mole-rat(101715155) ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080653 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029121 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029121 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029121 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047801 MISSION® esiRNA esiRNA human ATP6V1E2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080653 Rosetta Predictions human pricing
NM_001108979 Rosetta Predictions rat pricing
NM_029121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245207 predicted 1393
2 SASI_Hs01_00245202 predicted 1111
3 SASI_Hs01_00245203 predicted 1622
4 SASI_Hs01_00245205 predicted 1736
5 SASI_Hs01_00245206 predicted 1337
6 SASI_Hs01_00245208 predicted 1158
7 SASI_Hs01_00245209 predicted 1205
8 SASI_Hs01_00245210 predicted 1322
9 SASI_Hs01_00245211 predicted 1233
10 SASI_Hs02_00362403 predicted 1414
11 SASI_Hs01_00245204 predicted 1688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243974 predicted 708
2 SASI_Rn02_00243975 predicted 674
3 SASI_Rn02_00243976 predicted 451
4 SASI_Rn02_00243977 predicted 446
5 SASI_Rn02_00243978 predicted 614
6 SASI_Rn02_00243979 predicted 278
7 SASI_Rn02_00243980 predicted 758
8 SASI_Rn02_00243981 predicted 375
9 SASI_Rn02_00243982 predicted 214
10 SASI_Rn02_00243983 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062175 predicted 625
2 SASI_Mm01_00062176 predicted 208
3 SASI_Mm01_00062177 predicted 449
4 SASI_Mm01_00062178 predicted 430
5 SASI_Mm01_00062179 predicted 729
6 SASI_Mm01_00062180 predicted 446
7 SASI_Mm01_00062181 predicted 242
8 SASI_Mm01_00062182 predicted 762
9 SASI_Mm01_00062183 predicted 769
10 SASI_Mm01_00062184 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080653
VALIDATED
ATP6V1E2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1342s21c1
Sequence:CCGGGAATCAGGCGAGGCTGAAAGTCTCGAGACTTTCAGCCTCGCCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1571s21c1
Sequence:CCGGCCCGAGTACATGACAATTTCCCTCGAGGGAAATTGTCATGTACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1236s21c1
Sequence:CCGGAGAAAGGACGCCTCGTGCAAACTCGAGTTTGCACGAGGCGTCCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1412s21c1
Sequence:CCGGCTGAGACTCAGCAGGATTGTGCTCGAGCACAATCCTGCTGAGTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1494s21c1
Sequence:CCGGTGCTGGAACCTGTGATGATTGCTCGAGCAATCATCACAGGTTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1713s21c1
Sequence:CCGGTGGATCTCTCAGCCAAGCAAACTCGAGTTTGCTTGGCTGAGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_080653.3-1738s1c1
Sequence:CCGGGCCAGAAATACGAATGGCCTTCTCGAGAAGGCCATTCGTATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080653.3-1671s1c1
Sequence:CCGGGCAATCAGAGAATAAAGGTTTCTCGAGAAACCTTTATTCTCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080653.3-1373s1c1
Sequence:CCGGCGAAATGACCTCATCTCAGATCTCGAGATCTGAGATGAGGTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080653.3-1771s1c1
Sequence:CCGGCACCAACAGAAAGTTCTTTATCTCGAGATAAAGAACTTTCTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_080653.3-1262s1c1
Sequence:CCGGCGACTGAAGATTATGGAGTATCTCGAGATACTCCATAATCTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080653
VALIDATED
ATP6V1E2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1342s21c1
Sequence:CCGGGAATCAGGCGAGGCTGAAAGTCTCGAGACTTTCAGCCTCGCCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1571s21c1
Sequence:CCGGCCCGAGTACATGACAATTTCCCTCGAGGGAAATTGTCATGTACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1236s21c1
Sequence:CCGGAGAAAGGACGCCTCGTGCAAACTCGAGTTTGCACGAGGCGTCCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1412s21c1
Sequence:CCGGCTGAGACTCAGCAGGATTGTGCTCGAGCACAATCCTGCTGAGTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1494s21c1
Sequence:CCGGTGCTGGAACCTGTGATGATTGCTCGAGCAATCATCACAGGTTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1713s21c1
Sequence:CCGGTGGATCTCTCAGCCAAGCAAACTCGAGTTTGCTTGGCTGAGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_080653.3-1738s1c1
Sequence:CCGGGCCAGAAATACGAATGGCCTTCTCGAGAAGGCCATTCGTATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080653.3-1671s1c1
Sequence:CCGGGCAATCAGAGAATAAAGGTTTCTCGAGAAACCTTTATTCTCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080653.3-1373s1c1
Sequence:CCGGCGAAATGACCTCATCTCAGATCTCGAGATCTGAGATGAGGTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080653.3-1771s1c1
Sequence:CCGGCACCAACAGAAAGTTCTTTATCTCGAGATAAAGAACTTTCTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_080653.3-1262s1c1
Sequence:CCGGCGACTGAAGATTATGGAGTATCTCGAGATACTCCATAATCTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080653
VALIDATED
ATP6V1E2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1342s21c1
Sequence:CCGGGAATCAGGCGAGGCTGAAAGTCTCGAGACTTTCAGCCTCGCCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1571s21c1
Sequence:CCGGCCCGAGTACATGACAATTTCCCTCGAGGGAAATTGTCATGTACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1236s21c1
Sequence:CCGGAGAAAGGACGCCTCGTGCAAACTCGAGTTTGCACGAGGCGTCCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1412s21c1
Sequence:CCGGCTGAGACTCAGCAGGATTGTGCTCGAGCACAATCCTGCTGAGTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1494s21c1
Sequence:CCGGTGCTGGAACCTGTGATGATTGCTCGAGCAATCATCACAGGTTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080653.3-1713s21c1
Sequence:CCGGTGGATCTCTCAGCCAAGCAAACTCGAGTTTGCTTGGCTGAGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_080653.3-1738s1c1
Sequence:CCGGGCCAGAAATACGAATGGCCTTCTCGAGAAGGCCATTCGTATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080653.3-1671s1c1
Sequence:CCGGGCAATCAGAGAATAAAGGTTTCTCGAGAAACCTTTATTCTCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080653.3-1373s1c1
Sequence:CCGGCGAAATGACCTCATCTCAGATCTCGAGATCTGAGATGAGGTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080653.3-1771s1c1
Sequence:CCGGCACCAACAGAAAGTTCTTTATCTCGAGATAAAGAACTTTCTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_080653.3-1262s1c1
Sequence:CCGGCGACTGAAGATTATGGAGTATCTCGAGATACTCCATAATCTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029121
ATP6V1E2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029121.2-862s1c1
Sequence:CCGGGCCTTCAAAGTCTAAGTCATTCTCGAGAATGACTTAGACTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-401s1c1
Sequence:CCGGGCCCGAGACAATCTCATCTTACTCGAGTAAGATGAGATTGTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-452s1c1
Sequence:CCGGAGCAGAATTGTGTCGGATGAACTCGAGTTCATCCGACACAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-804s1c1
Sequence:CCGGCCAGCAGAAAGTTCTTTACATCTCGAGATGTAAAGAACTTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-295s1c1
Sequence:CCGGGCTGAAGATCATGGGTTATTTCTCGAGAAATAACCCATGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029121
ATP6V1E2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029121.2-862s1c1
Sequence:CCGGGCCTTCAAAGTCTAAGTCATTCTCGAGAATGACTTAGACTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-401s1c1
Sequence:CCGGGCCCGAGACAATCTCATCTTACTCGAGTAAGATGAGATTGTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-452s1c1
Sequence:CCGGAGCAGAATTGTGTCGGATGAACTCGAGTTCATCCGACACAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-804s1c1
Sequence:CCGGCCAGCAGAAAGTTCTTTACATCTCGAGATGTAAAGAACTTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-295s1c1
Sequence:CCGGGCTGAAGATCATGGGTTATTTCTCGAGAAATAACCCATGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029121
ATP6V1E2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029121.2-862s1c1
Sequence:CCGGGCCTTCAAAGTCTAAGTCATTCTCGAGAATGACTTAGACTTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-401s1c1
Sequence:CCGGGCCCGAGACAATCTCATCTTACTCGAGTAAGATGAGATTGTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-452s1c1
Sequence:CCGGAGCAGAATTGTGTCGGATGAACTCGAGTTCATCCGACACAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-804s1c1
Sequence:CCGGCCAGCAGAAAGTTCTTTACATCTCGAGATGTAAAGAACTTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029121.2-295s1c1
Sequence:CCGGGCTGAAGATCATGGGTTATTTCTCGAGAAATAACCCATGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks