EMAIL THIS PAGE TO A FRIEND

ATP6V1F

ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F

92 Gene Product Result for
Synonyms: ATP6S14 VATF Vma7
UniProtKB ID: Q16864, C9J2K4, Q6IBA8
Gene ID:
Human(9296) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is the V1 domain F subunit protein. [provided by RefSeq, Jul 2008]
Mouse(66144) ATPase, H+ transporting, lysosomal V1 subunit F
Rat(116664) ATPase, H transporting, lysosomal V1 subunit F
naked mole-rat(101714218) ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
domestic guinea pig(100730842) ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
sheep(101112724) ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
Zebrafish(436799) ATPase, H+ transporting, V1 subunit F
domestic cat(101081968) ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
cow(282405) ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
dog(475199) ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004231 Rosetta Predictions human pricing
NM_053884 Rosetta Predictions rat pricing
NM_025381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224662 predicted 346
2 SASI_Hs01_00224663 predicted 401
3 SASI_Hs01_00224664 predicted 436
4 SASI_Hs01_00224665 predicted 277
5 SASI_Hs02_00337150 predicted 389
6 SASI_Hs02_00337151 predicted 276
7 SASI_Hs02_00337152 predicted 431
8 SASI_Hs02_00337153 predicted 345
9 SASI_Hs02_00337154 predicted 331
10 SASI_Hs02_00337155 predicted 350
11 SASI_Hs01_00224656 predicted 212
12 SASI_Hs01_00224657 predicted 232
13 SASI_Hs01_00224658 predicted 210
14 SASI_Hs01_00224659 predicted 202
15 SASI_Hs01_00224660 predicted 215
16 SASI_Hs01_00224661 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104055 predicted 376
2 SASI_Rn02_00266791 predicted 221
3 SASI_Rn01_00104058 predicted 321
4 SASI_Rn01_00104059 predicted 242
5 SASI_Rn01_00104061 predicted 335
6 SASI_Rn01_00104062 predicted 271
7 SASI_Rn02_00266792 predicted 265
8 SASI_Rn02_00266793 predicted 395
9 SASI_Rn02_00266794 predicted 295
10 SASI_Rn01_00104056 predicted 199
11 SASI_Rn01_00104057 predicted 213
12 SASI_Rn01_00104060 predicted 413
13 SASI_Rn01_00104063 predicted 372
14 SASI_Rn01_00104064 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158775 predicted 217
2 SASI_Mm01_00158776 predicted 206
3 SASI_Mm01_00158777 predicted 363
4 SASI_Mm01_00158778 predicted 366
5 SASI_Mm01_00158779 predicted 381
6 SASI_Mm01_00158780 predicted 210
7 SASI_Mm01_00158783 predicted 300
8 SASI_Mm02_00328110 predicted 305
9 SASI_Mm01_00158781 predicted 369
10 SASI_Mm02_00328111 predicted 252
11 SASI_Mm01_00158782 predicted 374
12 SASI_Mm01_00158784 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004231
VALIDATED
ATP6V1F MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-218s1c1
Sequence:CCGGCGGCAATTTCTAAACCGGGATCTCGAGATCCCGGTTTAGAAATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-205s1c1
Sequence:CCGGCGAAGACACTTTCCGGCAATTCTCGAGAATTGCCGGAAAGTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004231.2-188s1c1
Sequence:CCGGACAACCATCAATGAGATCGAACTCGAGTTCGATCTCATTGATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-259s1c1
Sequence:CCGGCAACCAGTACATCGCAGAGATCTCGAGATCTCTGCGATGTACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-250s1c1
Sequence:CCGGCATCCTCATCAACCAGTACATCTCGAGATGTACTGGTTGATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004231.2-148s21c1
Sequence:CCGGCAAGAACCGCCATCCCAATTTCTCGAGAAATTGGGATGGCGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004231.2-87s21c1
Sequence:CCGGCAGTGATCGGAGACGAGGACACTCGAGTGTCCTCGTCTCCGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004231.2-475s21c1
Sequence:CCGGTTGCCATCAGCCTTCTTTACTCTCGAGAGTAAAGAAGGCTGATGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004231
VALIDATED
ATP6V1F MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-218s1c1
Sequence:CCGGCGGCAATTTCTAAACCGGGATCTCGAGATCCCGGTTTAGAAATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-205s1c1
Sequence:CCGGCGAAGACACTTTCCGGCAATTCTCGAGAATTGCCGGAAAGTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004231.2-188s1c1
Sequence:CCGGACAACCATCAATGAGATCGAACTCGAGTTCGATCTCATTGATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-259s1c1
Sequence:CCGGCAACCAGTACATCGCAGAGATCTCGAGATCTCTGCGATGTACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-250s1c1
Sequence:CCGGCATCCTCATCAACCAGTACATCTCGAGATGTACTGGTTGATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004231.2-148s21c1
Sequence:CCGGCAAGAACCGCCATCCCAATTTCTCGAGAAATTGGGATGGCGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004231.2-87s21c1
Sequence:CCGGCAGTGATCGGAGACGAGGACACTCGAGTGTCCTCGTCTCCGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004231.2-475s21c1
Sequence:CCGGTTGCCATCAGCCTTCTTTACTCTCGAGAGTAAAGAAGGCTGATGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004231
VALIDATED
ATP6V1F MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-218s1c1
Sequence:CCGGCGGCAATTTCTAAACCGGGATCTCGAGATCCCGGTTTAGAAATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-205s1c1
Sequence:CCGGCGAAGACACTTTCCGGCAATTCTCGAGAATTGCCGGAAAGTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004231.2-188s1c1
Sequence:CCGGACAACCATCAATGAGATCGAACTCGAGTTCGATCTCATTGATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-259s1c1
Sequence:CCGGCAACCAGTACATCGCAGAGATCTCGAGATCTCTGCGATGTACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004231.2-250s1c1
Sequence:CCGGCATCCTCATCAACCAGTACATCTCGAGATGTACTGGTTGATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004231.2-148s21c1
Sequence:CCGGCAAGAACCGCCATCCCAATTTCTCGAGAAATTGGGATGGCGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004231.2-87s21c1
Sequence:CCGGCAGTGATCGGAGACGAGGACACTCGAGTGTCCTCGTCTCCGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004231.2-475s21c1
Sequence:CCGGTTGCCATCAGCCTTCTTTACTCTCGAGAGTAAAGAAGGCTGATGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025381
VALIDATED
ATP6V1F MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-445s1c1
Sequence:CCGGCATGCTCTATTTAAGTGTCAACTCGAGTTGACACTTAAATAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-169s1c1
Sequence:CCGGTCAATGAGATCGAAGACACTTCTCGAGAAGTGTCTTCGATCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-180s1c1
Sequence:CCGGGAAGACACTTTCAGGCAATTTCTCGAGAAATTGCCTGAAAGTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-129s1c1
Sequence:CCGGCGCCACCCTAATTTCCTGGTACTCGAGTACCAGGAAATTAGGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-194s1c1
Sequence:CCGGGCAATTTCTAAACAGGGATGACTCGAGTCATCCCTGTTTAGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025381.2-193s21c1
Sequence:CCGGGCAATTTCTAAACAGGGATGACTCGAGTCATCCCTGTTTAGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025381.2-168s21c1
Sequence:CCGGTCAATGAGATCGAAGACACTTCTCGAGAAGTGTCTTCGATCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025381.2-179s21c1
Sequence:CCGGGAAGACACTTTCAGGCAATTTCTCGAGAAATTGCCTGAAAGTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025381.2-444s21c1
Sequence:CCGGCATGCTCTATTTAAGTGTCAACTCGAGTTGACACTTAAATAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025381
VALIDATED
ATP6V1F MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-445s1c1
Sequence:CCGGCATGCTCTATTTAAGTGTCAACTCGAGTTGACACTTAAATAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-169s1c1
Sequence:CCGGTCAATGAGATCGAAGACACTTCTCGAGAAGTGTCTTCGATCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-180s1c1
Sequence:CCGGGAAGACACTTTCAGGCAATTTCTCGAGAAATTGCCTGAAAGTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-129s1c1
Sequence:CCGGCGCCACCCTAATTTCCTGGTACTCGAGTACCAGGAAATTAGGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-194s1c1
Sequence:CCGGGCAATTTCTAAACAGGGATGACTCGAGTCATCCCTGTTTAGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025381.2-193s21c1
Sequence:CCGGGCAATTTCTAAACAGGGATGACTCGAGTCATCCCTGTTTAGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025381.2-168s21c1
Sequence:CCGGTCAATGAGATCGAAGACACTTCTCGAGAAGTGTCTTCGATCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025381.2-179s21c1
Sequence:CCGGGAAGACACTTTCAGGCAATTTCTCGAGAAATTGCCTGAAAGTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025381.2-444s21c1
Sequence:CCGGCATGCTCTATTTAAGTGTCAACTCGAGTTGACACTTAAATAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025381
VALIDATED
ATP6V1F MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-445s1c1
Sequence:CCGGCATGCTCTATTTAAGTGTCAACTCGAGTTGACACTTAAATAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-169s1c1
Sequence:CCGGTCAATGAGATCGAAGACACTTCTCGAGAAGTGTCTTCGATCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-180s1c1
Sequence:CCGGGAAGACACTTTCAGGCAATTTCTCGAGAAATTGCCTGAAAGTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-129s1c1
Sequence:CCGGCGCCACCCTAATTTCCTGGTACTCGAGTACCAGGAAATTAGGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025381.1-194s1c1
Sequence:CCGGGCAATTTCTAAACAGGGATGACTCGAGTCATCCCTGTTTAGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025381.2-193s21c1
Sequence:CCGGGCAATTTCTAAACAGGGATGACTCGAGTCATCCCTGTTTAGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025381.2-168s21c1
Sequence:CCGGTCAATGAGATCGAAGACACTTCTCGAGAAGTGTCTTCGATCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025381.2-179s21c1
Sequence:CCGGGAAGACACTTTCAGGCAATTTCTCGAGAAATTGCCTGAAAGTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025381.2-444s21c1
Sequence:CCGGCATGCTCTATTTAAGTGTCAACTCGAGTTGACACTTAAATAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks