EMAIL THIS PAGE TO A FRIEND

ATP6V1G1

ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1

110 Gene Product Result for
Synonyms: ATP6G ATP6G1 ATP6GL ATP6J Vma10
UniProtKB ID: O75348, Q6IB33
Gene ID:
Human(9550) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. The protein encoded by this gene is one of three V1 domain G subunit proteins. Pseudogenes of this gene have been characterized. [provided by RefSeq, Jul 2008]
Mouse(66290) ATPase, H+ transporting, lysosomal V1 subunit G1
Rat(298103) ATPase, H transporting, lysosomal V1 subunit G1
Zebrafish(335025) ATPase, H+ transporting, V1 subunit G isoform 1
chicken(417249) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
cow(281641) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
domestic cat(101098998) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
dog(612591) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
sheep(101103451) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
domestic guinea pig(100712974) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
naked mole-rat(101722194) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004888 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156241 MISSION® esiRNA esiRNA human ATP6V1G1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004888 Rosetta Predictions human pricing
NM_001106660 Rosetta Predictions rat pricing
NM_024173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338522 predicted 547
2 SASI_Hs01_00227268 predicted 390
3 SASI_Hs01_00227261 predicted 301
4 SASI_Hs01_00227262 predicted 537
5 SASI_Hs01_00227263 predicted 523
6 SASI_Hs02_00338523 predicted 535
7 SASI_Hs02_00338524 predicted 496
8 SASI_Hs02_00338525 predicted 432
9 SASI_Hs01_00227264 predicted 547
10 SASI_Hs01_00227260 predicted 537
11 SASI_Hs01_00227259 predicted 498
12 SASI_Hs01_00227265 predicted 558
13 SASI_Hs01_00227266 predicted 230
14 SASI_Hs01_00227267 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221138 predicted 554
2 SASI_Rn02_00221139 predicted 450
3 SASI_Rn02_00221140 predicted 449
4 SASI_Rn02_00221141 predicted 431
5 SASI_Rn02_00221142 predicted 241
6 SASI_Rn02_00221143 predicted 397
7 SASI_Rn02_00221144 predicted 414
8 SASI_Rn02_00221145 predicted 349
9 SASI_Rn02_00221146 predicted 509
10 SASI_Rn02_00221147 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199229 predicted 268
2 SASI_Mm01_00199231 predicted 266
3 SASI_Mm01_00199234 predicted 321
4 SASI_Mm02_00327481 predicted 394
5 SASI_Mm02_00327482 predicted 271
6 SASI_Mm02_00327483 predicted 265
7 SASI_Mm02_00327484 predicted 394
8 SASI_Mm01_00199227 predicted 247
9 SASI_Mm01_00199228 predicted 453
10 SASI_Mm02_00327485 predicted 209
11 SASI_Mm01_00199230 predicted 461
12 SASI_Mm01_00199232 predicted 412
13 SASI_Mm01_00199233 predicted 463
14 SASI_Mm01_00199235 predicted 458
15 SASI_Mm01_00199236 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004888
VALIDATED
ATP6V1G1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-237s21c1
Sequence:CCGGGAAGAAGCTCAGGCTGAAATTCTCGAGAATTTCAGCCTGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-369s21c1
Sequence:CCGGACCATCCTCCAGACATACTTCCTCGAGGAAGTATGTCTGGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004888.3-465s21c1
Sequence:CCGGTACCGCATAAATGGATAGAAGCTCGAGCTTCTATCCATTTATGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-515s21c1
Sequence:CCGGTTTAGATGCCCTCACGAATATCTCGAGATATTCGTGAGGGCATCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-272s21c1
Sequence:CCGGGCAGAGGGAGAAAGAATTCAACTCGAGTTGAATTCTTTCTCCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004888.2-345s1c1
Sequence:CCGGCCAGACATACTTCCGGCAGAACTCGAGTTCTGCCGGAAGTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004888.2-401s1c1
Sequence:CCGGTCTGTGACATTCGGCCAGAAACTCGAGTTTCTGGCCGAATGTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004888.2-333s1c1
Sequence:CCGGGATGACCATCCTCCAGACATACTCGAGTATGTCTGGAGGATGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004888.2-205s1c1
Sequence:CCGGGAAGAAGCTCAGGCTGAAATTCTCGAGAATTTCAGCCTGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004888
VALIDATED
ATP6V1G1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-237s21c1
Sequence:CCGGGAAGAAGCTCAGGCTGAAATTCTCGAGAATTTCAGCCTGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-369s21c1
Sequence:CCGGACCATCCTCCAGACATACTTCCTCGAGGAAGTATGTCTGGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004888.3-465s21c1
Sequence:CCGGTACCGCATAAATGGATAGAAGCTCGAGCTTCTATCCATTTATGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-515s21c1
Sequence:CCGGTTTAGATGCCCTCACGAATATCTCGAGATATTCGTGAGGGCATCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-272s21c1
Sequence:CCGGGCAGAGGGAGAAAGAATTCAACTCGAGTTGAATTCTTTCTCCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004888.2-345s1c1
Sequence:CCGGCCAGACATACTTCCGGCAGAACTCGAGTTCTGCCGGAAGTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004888.2-401s1c1
Sequence:CCGGTCTGTGACATTCGGCCAGAAACTCGAGTTTCTGGCCGAATGTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004888.2-333s1c1
Sequence:CCGGGATGACCATCCTCCAGACATACTCGAGTATGTCTGGAGGATGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004888.2-205s1c1
Sequence:CCGGGAAGAAGCTCAGGCTGAAATTCTCGAGAATTTCAGCCTGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004888
VALIDATED
ATP6V1G1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-237s21c1
Sequence:CCGGGAAGAAGCTCAGGCTGAAATTCTCGAGAATTTCAGCCTGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-369s21c1
Sequence:CCGGACCATCCTCCAGACATACTTCCTCGAGGAAGTATGTCTGGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004888.3-465s21c1
Sequence:CCGGTACCGCATAAATGGATAGAAGCTCGAGCTTCTATCCATTTATGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-515s21c1
Sequence:CCGGTTTAGATGCCCTCACGAATATCTCGAGATATTCGTGAGGGCATCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004888.3-272s21c1
Sequence:CCGGGCAGAGGGAGAAAGAATTCAACTCGAGTTGAATTCTTTCTCCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004888.2-345s1c1
Sequence:CCGGCCAGACATACTTCCGGCAGAACTCGAGTTCTGCCGGAAGTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004888.2-401s1c1
Sequence:CCGGTCTGTGACATTCGGCCAGAAACTCGAGTTTCTGGCCGAATGTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004888.2-333s1c1
Sequence:CCGGGATGACCATCCTCCAGACATACTCGAGTATGTCTGGAGGATGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004888.2-205s1c1
Sequence:CCGGGAAGAAGCTCAGGCTGAAATTCTCGAGAATTTCAGCCTGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024173
VALIDATED
ATP6V1G1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-833s1c1
Sequence:CCGGGCTATTAGTAACTCCTATGAACTCGAGTTCATAGGAGTTACTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024173.1-364s1c1
Sequence:CCGGACAGGGATGAAGTCCTGGATACTCGAGTATCCAGGACTTCATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-183s1c1
Sequence:CCGGCGGAGGCTGAAGCAGGCCAAACTCGAGTTTGGCCTGCTTCAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-378s1c1
Sequence:CCGGCTGGATAACCTCTTGGCCTTTCTCGAGAAAGGCCAAGAGGTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-344s1c1
Sequence:CCGGCCAGAACTACTTCGAGCAGAACTCGAGTTCTGCTCGAAGTAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024173
VALIDATED
ATP6V1G1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-833s1c1
Sequence:CCGGGCTATTAGTAACTCCTATGAACTCGAGTTCATAGGAGTTACTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024173.1-364s1c1
Sequence:CCGGACAGGGATGAAGTCCTGGATACTCGAGTATCCAGGACTTCATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-183s1c1
Sequence:CCGGCGGAGGCTGAAGCAGGCCAAACTCGAGTTTGGCCTGCTTCAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-378s1c1
Sequence:CCGGCTGGATAACCTCTTGGCCTTTCTCGAGAAAGGCCAAGAGGTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-344s1c1
Sequence:CCGGCCAGAACTACTTCGAGCAGAACTCGAGTTCTGCTCGAAGTAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024173
VALIDATED
ATP6V1G1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-833s1c1
Sequence:CCGGGCTATTAGTAACTCCTATGAACTCGAGTTCATAGGAGTTACTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024173.1-364s1c1
Sequence:CCGGACAGGGATGAAGTCCTGGATACTCGAGTATCCAGGACTTCATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-183s1c1
Sequence:CCGGCGGAGGCTGAAGCAGGCCAAACTCGAGTTTGGCCTGCTTCAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-378s1c1
Sequence:CCGGCTGGATAACCTCTTGGCCTTTCTCGAGAAAGGCCAAGAGGTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024173.1-344s1c1
Sequence:CCGGCCAGAACTACTTCGAGCAGAACTCGAGTTCTGCTCGAAGTAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks