EMAIL THIS PAGE TO A FRIEND

ATP6V1G3

ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3

70 Gene Product Result for
Synonyms: ATP6G3 Vma10
UniProtKB ID: Q96LB4, Q495K2, Q495K4, Q5T9L6
Gene ID:
Human(127124) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'' and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three G subunit proteins. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(338375) ATPase, H+ transporting, lysosomal V1 subunit G3
Rat(289407) ATPase, H+ transporting, lysosomal V1 subunit G3
chicken(424349) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
domestic cat(101093576) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
cow(613925) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
dog(490256) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
sheep(101102659) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
domestic guinea pig(100712761) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
naked mole-rat(101710875) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133262 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133262 Rosetta Predictions human pricing
NM_133326 Rosetta Predictions human pricing
NM_001105991 Rosetta Predictions rat pricing
NM_177397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140267 predicted 213
2 SASI_Hs01_00140268 predicted 252
3 SASI_Hs01_00140270 predicted 208
4 SASI_Hs01_00140271 predicted 212
5 SASI_Hs01_00140272 predicted 219
6 SASI_Hs02_00362962 predicted 235
7 SASI_Hs01_00140274 predicted 255
8 SASI_Hs01_00140275 predicted 232
9 SASI_Hs01_00140276 predicted 259
10 SASI_Hs02_00362963 predicted 239
11 SASI_Hs01_00140269 predicted 223
12 SASI_Hs01_00140273 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237519 predicted 250
2 SASI_Hs02_00362995 predicted 212
3 SASI_Hs01_00237520 predicted 293
4 SASI_Hs02_00362996 predicted 255
5 SASI_Hs01_00237522 predicted 237
6 SASI_Hs01_00237524 predicted 301
7 SASI_Hs01_00237525 predicted 279
8 SASI_Hs01_00237526 predicted 301
9 SASI_Hs02_00362997 predicted 286
10 SASI_Hs01_00237527 predicted 208
11 SASI_Hs01_00237521 predicted 261
12 SASI_Hs01_00237523 predicted 257
13 SASI_Hs01_00237528 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214552 predicted 450
2 SASI_Rn02_00214553 predicted 415
3 SASI_Rn02_00214554 predicted 405
4 SASI_Rn02_00214555 predicted 840
5 SASI_Rn02_00214556 predicted 420
6 SASI_Rn02_00214557 predicted 879
7 SASI_Rn02_00214558 predicted 875
8 SASI_Rn02_00214559 predicted 697
9 SASI_Rn02_00214560 predicted 751
10 SASI_Rn02_00214561 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198468 predicted 420
2 SASI_Mm01_00198469 predicted 251
3 SASI_Mm01_00198470 predicted 394
4 SASI_Mm01_00198471 predicted 607
5 SASI_Mm01_00198472 predicted 453
6 SASI_Mm01_00198473 predicted 407
7 SASI_Mm01_00198474 predicted 568
8 SASI_Mm01_00198475 predicted 652
9 SASI_Mm02_00347597 predicted 517
10 SASI_Mm01_00198477 predicted 279
11 SASI_Mm01_00198476 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177397
ATP6V1G3 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177397.3-659s21c1
Sequence:CCGGGAAGGTGCTTTATTAGGTATTCTCGAGAATACCTAATAAAGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177397.3-228s21c1
Sequence:CCGGGCCACCTCTCGGATGAAATAGCTCGAGCTATTTCATCCGAGAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177397.2-1275s1c1
Sequence:CCGGCCCTGCTCATAATGGTCATTACTCGAGTAATGACCATTATGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-298s1c1
Sequence:CCGGGTGTATGGAAAGCGTGATTAACTCGAGTTAATCACGCTTTCCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-335s1c1
Sequence:CCGGGTGTGCGACATGAAACCAGAACTCGAGTTCTGGTTTCATGTCGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-88s1c1
Sequence:CCGGCAAGCTAGATGAGGCAAAGAACTCGAGTTCTTTGCCTCATCTAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-194s1c1
Sequence:CCGGCGCCTGAAGCAGGCTAAGATACTCGAGTATCTTAGCCTGCTTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177397
ATP6V1G3 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177397.3-659s21c1
Sequence:CCGGGAAGGTGCTTTATTAGGTATTCTCGAGAATACCTAATAAAGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177397.3-228s21c1
Sequence:CCGGGCCACCTCTCGGATGAAATAGCTCGAGCTATTTCATCCGAGAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177397.2-1275s1c1
Sequence:CCGGCCCTGCTCATAATGGTCATTACTCGAGTAATGACCATTATGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-298s1c1
Sequence:CCGGGTGTATGGAAAGCGTGATTAACTCGAGTTAATCACGCTTTCCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-335s1c1
Sequence:CCGGGTGTGCGACATGAAACCAGAACTCGAGTTCTGGTTTCATGTCGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-88s1c1
Sequence:CCGGCAAGCTAGATGAGGCAAAGAACTCGAGTTCTTTGCCTCATCTAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-194s1c1
Sequence:CCGGCGCCTGAAGCAGGCTAAGATACTCGAGTATCTTAGCCTGCTTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177397
ATP6V1G3 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177397.3-659s21c1
Sequence:CCGGGAAGGTGCTTTATTAGGTATTCTCGAGAATACCTAATAAAGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177397.3-228s21c1
Sequence:CCGGGCCACCTCTCGGATGAAATAGCTCGAGCTATTTCATCCGAGAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177397.2-1275s1c1
Sequence:CCGGCCCTGCTCATAATGGTCATTACTCGAGTAATGACCATTATGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-298s1c1
Sequence:CCGGGTGTATGGAAAGCGTGATTAACTCGAGTTAATCACGCTTTCCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-335s1c1
Sequence:CCGGGTGTGCGACATGAAACCAGAACTCGAGTTCTGGTTTCATGTCGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-88s1c1
Sequence:CCGGCAAGCTAGATGAGGCAAAGAACTCGAGTTCTTTGCCTCATCTAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177397.2-194s1c1
Sequence:CCGGCGCCTGAAGCAGGCTAAGATACTCGAGTATCTTAGCCTGCTTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133262
ATP6V1G3 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-444s21c1
Sequence:CCGGACTACAGAGCCACCAACTAAACTCGAGTTTAGTTGGTGGCTCTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-286s21c1
Sequence:CCGGTAAGATAATGGGCTCTCAGAACTCGAGTTCTGAGAGCCCATTATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-355s21c1
Sequence:CCGGACTTAATGGACACTACAATAACTCGAGTTATTGTAGTGTCCATTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-259s21c1
Sequence:CCGGAGATAAAGAGTTTCGACTAAACTCGAGTTTAGTCGAAACTCTTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-302s1c1
Sequence:CCGGCAGAATAATCTCTCAGATGAACTCGAGTTCATCTGAGAGATTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-216s1c1
Sequence:CCGGAGGAGGAAGCAATGGTAGAAACTCGAGTTTCTACCATTGCTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-376s1c1
Sequence:CCGGGTATATGGAAAGTGTGATGAACTCGAGTTCATCACACTTTCCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-338s1c1
Sequence:CCGGCTAGGGAAGATACAAGAACTTCTCGAGAAGTTCTTGTATCTTCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-158s1c1
Sequence:CCGGGCCAAGGACAAGCTAGAGGAACTCGAGTTCCTCTAGCTTGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133262
ATP6V1G3 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-444s21c1
Sequence:CCGGACTACAGAGCCACCAACTAAACTCGAGTTTAGTTGGTGGCTCTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-286s21c1
Sequence:CCGGTAAGATAATGGGCTCTCAGAACTCGAGTTCTGAGAGCCCATTATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-355s21c1
Sequence:CCGGACTTAATGGACACTACAATAACTCGAGTTATTGTAGTGTCCATTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-259s21c1
Sequence:CCGGAGATAAAGAGTTTCGACTAAACTCGAGTTTAGTCGAAACTCTTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-302s1c1
Sequence:CCGGCAGAATAATCTCTCAGATGAACTCGAGTTCATCTGAGAGATTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-216s1c1
Sequence:CCGGAGGAGGAAGCAATGGTAGAAACTCGAGTTTCTACCATTGCTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-376s1c1
Sequence:CCGGGTATATGGAAAGTGTGATGAACTCGAGTTCATCACACTTTCCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-338s1c1
Sequence:CCGGCTAGGGAAGATACAAGAACTTCTCGAGAAGTTCTTGTATCTTCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-158s1c1
Sequence:CCGGGCCAAGGACAAGCTAGAGGAACTCGAGTTCCTCTAGCTTGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133262
ATP6V1G3 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-444s21c1
Sequence:CCGGACTACAGAGCCACCAACTAAACTCGAGTTTAGTTGGTGGCTCTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-286s21c1
Sequence:CCGGTAAGATAATGGGCTCTCAGAACTCGAGTTCTGAGAGCCCATTATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-355s21c1
Sequence:CCGGACTTAATGGACACTACAATAACTCGAGTTATTGTAGTGTCCATTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133262.2-259s21c1
Sequence:CCGGAGATAAAGAGTTTCGACTAAACTCGAGTTTAGTCGAAACTCTTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-302s1c1
Sequence:CCGGCAGAATAATCTCTCAGATGAACTCGAGTTCATCTGAGAGATTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-216s1c1
Sequence:CCGGAGGAGGAAGCAATGGTAGAAACTCGAGTTTCTACCATTGCTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-376s1c1
Sequence:CCGGGTATATGGAAAGTGTGATGAACTCGAGTTCATCACACTTTCCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-338s1c1
Sequence:CCGGCTAGGGAAGATACAAGAACTTCTCGAGAAGTTCTTGTATCTTCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133262.2-158s1c1
Sequence:CCGGGCCAAGGACAAGCTAGAGGAACTCGAGTTCCTCTAGCTTGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks