EMAIL THIS PAGE TO A FRIEND

ATP6V1H

ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H

108 Gene Product Result for
Synonyms: MSTP042 NBP1 SFD SFDalpha SFDbeta VMA13
UniProtKB ID: Q9UI12, B3KMR0, Q6PK44, Q9H3E3, Q9Y300
Gene ID:
Human(51606) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular organelles. V-ATPase-dependent organelle acidification is necessary for multiple processes including protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. The encoded protein is the regulatory H subunit of the V1 domain of V-ATPase, which is required for catalysis of ATP but not the assembly of V-ATPase. Decreased expression of this gene may play a role in the development of type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(108664) ATPase, H+ transporting, lysosomal V1 subunit H
Rat(297797) ATPase, H+ transporting, lysosomal V1 subunit H
naked mole-rat(101710987) ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
domestic guinea pig(100716527) ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
sheep(101113504) ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
Zebrafish(286779) ATPase, H+ transporting, lysosomal, V1 subunit H
chicken(426199) ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
cow(282657) ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
dog(486953) ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
domestic cat(101095225) ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015941 Rosetta Predictions human pricing
NM_213619 Rosetta Predictions human pricing
NM_213620 Rosetta Predictions human pricing
NM_001013929 Rosetta Predictions rat pricing
NM_133826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021844 predicted 1276
2 SASI_Hs01_00021845 predicted 1442
3 SASI_Hs01_00021846 predicted 1133
4 SASI_Hs01_00021848 predicted 1428
5 SASI_Hs01_00021849 predicted 1126
6 SASI_Hs01_00021850 predicted 1544
7 SASI_Hs01_00021851 predicted 1835
8 SASI_Hs01_00021852 predicted 1229
9 SASI_Hs02_00348578 predicted 582
10 SASI_Hs01_00021847 predicted 1126
11 SASI_Hs01_00021853 predicted 1834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029568 predicted 1222
2 SASI_Hs01_00029569 predicted 1394
3 SASI_Hs01_00029570 predicted 1077
4 SASI_Hs01_00029572 predicted 1377
5 SASI_Hs01_00029573 predicted 1071
6 SASI_Hs01_00029574 predicted 1490
7 SASI_Hs01_00029575 predicted 1777
8 SASI_Hs01_00029576 predicted 1169
9 SASI_Hs02_00374304 predicted 583
10 SASI_Hs01_00029571 predicted 1071
11 SASI_Hs01_00029577 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156329 predicted 1137
2 SASI_Hs01_00156330 predicted 1306
3 SASI_Hs01_00156331 predicted 998
4 SASI_Hs01_00156333 predicted 1291
5 SASI_Hs01_00156334 predicted 986
6 SASI_Hs01_00156335 predicted 1400
7 SASI_Hs01_00156336 predicted 1690
8 SASI_Hs01_00156337 predicted 1083
9 SASI_Hs02_00374305 predicted 440
10 SASI_Hs01_00156332 predicted 979
11 SASI_Hs01_00156338 predicted 1698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101474 predicted 938
2 SASI_Rn01_00101475 predicted 1068
3 SASI_Rn01_00101477 predicted 1272
4 SASI_Rn01_00101478 predicted 674
5 SASI_Rn01_00101479 predicted 1139
6 SASI_Rn01_00101480 predicted 564
7 SASI_Rn01_00101481 predicted 1078
8 SASI_Rn01_00101482 predicted 659
9 SASI_Rn01_00101483 predicted 908
10 SASI_Rn02_00201229 predicted 922
11 SASI_Rn01_00101476 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093922 predicted 1045
2 SASI_Mm01_00093924 predicted 1071
3 SASI_Mm01_00093925 predicted 414
4 SASI_Mm01_00093926 predicted 1292
5 SASI_Mm01_00093927 predicted 1338
6 SASI_Mm02_00338845 predicted 680
7 SASI_Mm01_00093928 predicted 1380
8 SASI_Mm01_00093929 predicted 886
9 SASI_Mm01_00093930 predicted 1529
10 SASI_Mm01_00093931 predicted 472
11 SASI_Mm01_00093923 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015941
VALIDATED
ATP6V1H MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-980s1c1
Sequence:CCGGCCTGGCATTCAGTCCTCAAATCTCGAGATTTGAGGACTGAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015941.1-315s1c1
Sequence:CCGGGCAAACAAAGTCAACTGGCAACTCGAGTTGCCAGTTGACTTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-499s1c1
Sequence:CCGGCCGTTCAGTATATACTAACTACTCGAGTAGTTAGTATATACTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-1017s1c1
Sequence:CCGGCGCTATAATATCATTCCAGTTCTCGAGAACTGGAATGATATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-1464s1c1
Sequence:CCGGGCTCACGATGTTGGAGAATATCTCGAGATATTCTCCAACATCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-1000s21c1
Sequence:CCGGCTTTCAGCTCCAGTATCAAATCTCGAGATTTGATACTGGAGCTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-1523s21c1
Sequence:CCGGGCTCACGATGTTGGAGAATATCTCGAGATATTCTCCAACATCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-1836s21c1
Sequence:CCGGTTGGAATTTCCTCTGTTATATCTCGAGATATAACAGAGGAAATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-1625s21c1
Sequence:CCGGGACCAGCAGGTCCGCTATAATCTCGAGATTATAGCGGACCTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-1536s21c1
Sequence:CCGGGAGAATATGTGCGGCATTATCCTCGAGGATAATGCCGCACATATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-1424s21c1
Sequence:CCGGGAGAATGCTGTGAGGTTAAATCTCGAGATTTAACCTCACAGCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-864s21c1
Sequence:CCGGCAAGTGATAGTTCGCAGTATGCTCGAGCATACTGCGAACTATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-691s21c1
Sequence:CCGGGGATCCCTTCACTGTTCATATCTCGAGATATGAACAGTGAAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015941
VALIDATED
ATP6V1H MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-980s1c1
Sequence:CCGGCCTGGCATTCAGTCCTCAAATCTCGAGATTTGAGGACTGAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015941.1-315s1c1
Sequence:CCGGGCAAACAAAGTCAACTGGCAACTCGAGTTGCCAGTTGACTTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-499s1c1
Sequence:CCGGCCGTTCAGTATATACTAACTACTCGAGTAGTTAGTATATACTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-1017s1c1
Sequence:CCGGCGCTATAATATCATTCCAGTTCTCGAGAACTGGAATGATATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-1464s1c1
Sequence:CCGGGCTCACGATGTTGGAGAATATCTCGAGATATTCTCCAACATCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-1000s21c1
Sequence:CCGGCTTTCAGCTCCAGTATCAAATCTCGAGATTTGATACTGGAGCTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-1523s21c1
Sequence:CCGGGCTCACGATGTTGGAGAATATCTCGAGATATTCTCCAACATCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-1836s21c1
Sequence:CCGGTTGGAATTTCCTCTGTTATATCTCGAGATATAACAGAGGAAATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-1625s21c1
Sequence:CCGGGACCAGCAGGTCCGCTATAATCTCGAGATTATAGCGGACCTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-1536s21c1
Sequence:CCGGGAGAATATGTGCGGCATTATCCTCGAGGATAATGCCGCACATATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-1424s21c1
Sequence:CCGGGAGAATGCTGTGAGGTTAAATCTCGAGATTTAACCTCACAGCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-864s21c1
Sequence:CCGGCAAGTGATAGTTCGCAGTATGCTCGAGCATACTGCGAACTATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-691s21c1
Sequence:CCGGGGATCCCTTCACTGTTCATATCTCGAGATATGAACAGTGAAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015941
VALIDATED
ATP6V1H MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-980s1c1
Sequence:CCGGCCTGGCATTCAGTCCTCAAATCTCGAGATTTGAGGACTGAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015941.1-315s1c1
Sequence:CCGGGCAAACAAAGTCAACTGGCAACTCGAGTTGCCAGTTGACTTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-499s1c1
Sequence:CCGGCCGTTCAGTATATACTAACTACTCGAGTAGTTAGTATATACTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-1017s1c1
Sequence:CCGGCGCTATAATATCATTCCAGTTCTCGAGAACTGGAATGATATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015941.1-1464s1c1
Sequence:CCGGGCTCACGATGTTGGAGAATATCTCGAGATATTCTCCAACATCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-1000s21c1
Sequence:CCGGCTTTCAGCTCCAGTATCAAATCTCGAGATTTGATACTGGAGCTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-1523s21c1
Sequence:CCGGGCTCACGATGTTGGAGAATATCTCGAGATATTCTCCAACATCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-1836s21c1
Sequence:CCGGTTGGAATTTCCTCTGTTATATCTCGAGATATAACAGAGGAAATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-1625s21c1
Sequence:CCGGGACCAGCAGGTCCGCTATAATCTCGAGATTATAGCGGACCTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-1536s21c1
Sequence:CCGGGAGAATATGTGCGGCATTATCCTCGAGGATAATGCCGCACATATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-1424s21c1
Sequence:CCGGGAGAATGCTGTGAGGTTAAATCTCGAGATTTAACCTCACAGCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015941.2-864s21c1
Sequence:CCGGCAAGTGATAGTTCGCAGTATGCTCGAGCATACTGCGAACTATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015941.2-691s21c1
Sequence:CCGGGGATCCCTTCACTGTTCATATCTCGAGATATGAACAGTGAAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133826
VALIDATED
ATP6V1H MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133826.2-1717s1c1
Sequence:CCGGCTATGGTAATTCCTGGGAGAACTCGAGTTCTCCCAGGAATTACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133826.2-925s1c1
Sequence:CCGGCGCTATAATATCATTCCTGTTCTCGAGAACAGGAATGATATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133826.2-1060s1c1
Sequence:CCGGCTGGCTATGATTCAATGCAAACTCGAGTTTGCATTGAATCATAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133826.2-1185s1c1
Sequence:CCGGCCTTAGCTCATTTGATGAATACTCGAGTATTCATCAAATGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133826.2-565s1c1
Sequence:CCGGGCAAGAATTATCGCCAAGTTACTCGAGTAACTTGGCGATAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133826.4-1716s21c1
Sequence:CCGGCTATGGTAATTCCTGGGAGAACTCGAGTTCTCCCAGGAATTACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-1059s21c1
Sequence:CCGGCTGGCTATGATTCAATGCAAACTCGAGTTTGCATTGAATCATAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-564s21c1
Sequence:CCGGGCAAGAATTATCGCCAAGTTACTCGAGTAACTTGGCGATAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-924s21c1
Sequence:CCGGCGCTATAATATCATTCCTGTTCTCGAGAACAGGAATGATATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-1184s21c1
Sequence:CCGGCCTTAGCTCATTTGATGAATACTCGAGTATTCATCAAATGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133826
VALIDATED
ATP6V1H MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133826.2-1717s1c1
Sequence:CCGGCTATGGTAATTCCTGGGAGAACTCGAGTTCTCCCAGGAATTACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133826.2-925s1c1
Sequence:CCGGCGCTATAATATCATTCCTGTTCTCGAGAACAGGAATGATATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133826.2-1060s1c1
Sequence:CCGGCTGGCTATGATTCAATGCAAACTCGAGTTTGCATTGAATCATAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133826.2-1185s1c1
Sequence:CCGGCCTTAGCTCATTTGATGAATACTCGAGTATTCATCAAATGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133826.2-565s1c1
Sequence:CCGGGCAAGAATTATCGCCAAGTTACTCGAGTAACTTGGCGATAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133826.4-1716s21c1
Sequence:CCGGCTATGGTAATTCCTGGGAGAACTCGAGTTCTCCCAGGAATTACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-1059s21c1
Sequence:CCGGCTGGCTATGATTCAATGCAAACTCGAGTTTGCATTGAATCATAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-564s21c1
Sequence:CCGGGCAAGAATTATCGCCAAGTTACTCGAGTAACTTGGCGATAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-924s21c1
Sequence:CCGGCGCTATAATATCATTCCTGTTCTCGAGAACAGGAATGATATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-1184s21c1
Sequence:CCGGCCTTAGCTCATTTGATGAATACTCGAGTATTCATCAAATGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133826
VALIDATED
ATP6V1H MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133826.2-1717s1c1
Sequence:CCGGCTATGGTAATTCCTGGGAGAACTCGAGTTCTCCCAGGAATTACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133826.2-925s1c1
Sequence:CCGGCGCTATAATATCATTCCTGTTCTCGAGAACAGGAATGATATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133826.2-1060s1c1
Sequence:CCGGCTGGCTATGATTCAATGCAAACTCGAGTTTGCATTGAATCATAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133826.2-1185s1c1
Sequence:CCGGCCTTAGCTCATTTGATGAATACTCGAGTATTCATCAAATGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133826.2-565s1c1
Sequence:CCGGGCAAGAATTATCGCCAAGTTACTCGAGTAACTTGGCGATAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133826.4-1716s21c1
Sequence:CCGGCTATGGTAATTCCTGGGAGAACTCGAGTTCTCCCAGGAATTACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-1059s21c1
Sequence:CCGGCTGGCTATGATTCAATGCAAACTCGAGTTTGCATTGAATCATAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-564s21c1
Sequence:CCGGGCAAGAATTATCGCCAAGTTACTCGAGTAACTTGGCGATAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-924s21c1
Sequence:CCGGCGCTATAATATCATTCCTGTTCTCGAGAACAGGAATGATATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133826.4-1184s21c1
Sequence:CCGGCCTTAGCTCATTTGATGAATACTCGAGTATTCATCAAATGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks