EMAIL THIS PAGE TO A FRIEND

ATP7A

ATPase, Cu++ transporting, alpha polypeptide

241 Gene Product Result for
Synonyms: DSMAX MK MNK SMAX3
UniProtKB ID: Q04656, B1AT72, O00227, O00745, Q9BYY8
Gene ID:
Human(538) Summary: This gene encodes a transmembrane protein that functions in copper transport across membranes. This protein is localized to the trans-Golgi network, where it is predicted to supply copper to copper-dependent enzymes in the secretory pathway. It relocalizes to the plasma membrane under conditions of elevated extracellular copper, and functions in the efflux of copper from cells. Mutations in this gene are associated with Menkes disease, X-linked cutis laxa, and occipital horn syndrome. [provided by RefSeq, Oct 2011]
Mouse(11977) ATPase, Cu++ transporting, alpha polypeptide
Rat(24941) ATPase, Cu++ transporting, alpha polypeptide
Zebrafish(564924) ATPase, Cu++ transporting, alpha polypeptide
cow(541275) ATPase, Cu++ transporting, alpha polypeptide
Horse(100071762) ATPase, Cu++ transporting, alpha polypeptide
domestic cat(493745) ATPase, Cu++ transporting, alpha polypeptide
domestic cat(101086954) ATPase, Cu++ transporting, alpha polypeptide
dog(406185) ATPase, Cu++ transporting, alpha polypeptide
chicken(422333) ATPase, Cu++ transporting, alpha polypeptide
chicken(101666290) ATPase, Cu++ transporting, alpha polypeptide
chicken(101747741) ATPase, Cu++ transporting, alpha polypeptide
sheep(101116379) ATPase, Cu++ transporting, alpha polypeptide
domestic guinea pig(100714402) ATPase, Cu++ transporting, alpha polypeptide
naked mole-rat(101715343) ATPase, Cu++ transporting, alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21023 Anti-ATP7A antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
HPA012887 Anti-ATP7A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV33797 Anti-ATP7A antibody produced in rabbit affinity isolated antibody, lyophilized powder human, canine, rat, mouse
immunohistochemistry, western blot pricing
SAB2104637 Anti-ATP7A antibody produced in rabbit affinity isolated antibody human, rat, horse, mouse, guinea pig, canine, pig, rabbit
western blot pricing
HPA048107 Anti-ATP7A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB5200339 Monoclonal Anti-Copper Transporting Atpase 1 - Alkaline Phosphatase antibody produced in mouse clone S60-4, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200340 Monoclonal Anti-Copper Transporting Atpase 1 - Apc antibody produced in mouse clone S60-4, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200331 Monoclonal Anti-Copper Transporting Atpase 1 - Atto 390 antibody produced in mouse clone S60-4, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200332 Monoclonal Anti-Copper Transporting Atpase 1 - Atto 488 antibody produced in mouse clone S60-4, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200333 Monoclonal Anti-Copper Transporting Atpase 1 - Atto 565 antibody produced in mouse clone S60-4, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200334 Monoclonal Anti-Copper Transporting Atpase 1 - Atto 594 antibody produced in mouse clone S60-4, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200335 Monoclonal Anti-Copper Transporting Atpase 1 - Atto 633 antibody produced in mouse clone S60-4, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200336 Monoclonal Anti-Copper Transporting Atpase 1 - Atto 655 antibody produced in mouse clone S60-4, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200337 Monoclonal Anti-Copper Transporting Atpase 1 - Atto 680 antibody produced in mouse clone S60-4, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200338 Monoclonal Anti-Copper Transporting Atpase 1 - Atto 700 antibody produced in mouse clone S60-4, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200341 Monoclonal Anti-Copper Transporting Atpase 1 - Biotin antibody produced in mouse clone S60-4, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200342 Monoclonal Anti-Copper Transporting Atpase 1 - Fitc antibody produced in mouse clone S60-4, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200343 Monoclonal Anti-Copper Transporting Atpase 1 - Hrp antibody produced in mouse clone S60-4, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200344 Monoclonal Anti-Copper Transporting Atpase 1 - Pe/Atto 594 antibody produced in mouse clone S60-4, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200345 Monoclonal Anti-Copper Transporting Atpase 1 - Percp antibody produced in mouse clone S60-4, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200346 Monoclonal Anti-Copper Transporting Atpase 1 - Rpe antibody produced in mouse clone S60-4, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200347 Monoclonal Anti-Copper Transporting Atpase 1 - Streptavidin antibody produced in mouse clone S60-4, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200330 Monoclonal Anti-Copper Transporting Atpase 1 antibody produced in mouse clone S60-4, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000052 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000052 Rosetta Predictions human pricing
NM_052803 Rosetta Predictions rat pricing
NM_001109757 Rosetta Predictions mouse pricing
NM_009726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129917 predicted 2160
2 SASI_Hs01_00129918 predicted 2587
3 SASI_Hs01_00129919 predicted 1309
4 SASI_Hs01_00129921 predicted 860
5 SASI_Hs01_00129920 predicted 4181
6 SASI_Hs01_00129922 predicted 204
7 SASI_Hs02_00301756 predicted 2131
8 SASI_Hs02_00301757 predicted 1991
9 SASI_Hs01_00129925 predicted 3233
10 SASI_Hs02_00301758 predicted 2243
11 SASI_Hs01_00129916 predicted 2079
12 SASI_Hs01_00129923 predicted 959
13 SASI_Hs01_00129924 predicted 4394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090334 predicted 2453
2 SASI_Rn01_00090335 predicted 1199
3 SASI_Rn01_00090336 predicted 933
4 SASI_Rn01_00090337 predicted 1324
5 SASI_Rn01_00090338 predicted 213
6 SASI_Rn01_00090339 predicted 641
7 SASI_Rn01_00090340 predicted 4230
8 SASI_Rn02_00265594 predicted 2741
9 SASI_Rn01_00090341 predicted 3189
10 SASI_Rn01_00090342 predicted 964
11 SASI_Rn01_00090343 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304304 predicted 2541
2 SASI_Mm02_00304305 predicted 1136
3 SASI_Mm02_00304306 predicted 3002
4 SASI_Mm02_00304307 predicted 309
5 SASI_Mm02_00304308 predicted 867
6 SASI_Mm02_00304309 predicted 2185
7 SASI_Mm02_00304310 predicted 3283
8 SASI_Mm02_00304311 predicted 3463
9 SASI_Mm02_00304312 predicted 1057
10 SASI_Mm02_00304313 predicted 4145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185522 predicted 2543
2 SASI_Mm01_00185523 predicted 1143
3 SASI_Mm02_00316884 predicted 2997
4 SASI_Mm01_00185524 predicted 309
5 SASI_Mm02_00316885 predicted 859
6 SASI_Mm01_00185526 predicted 2180
7 SASI_Mm01_00185527 predicted 3281
8 SASI_Mm01_00185529 predicted 3464
9 SASI_Mm01_00185530 predicted 1054
10 SASI_Mm02_00316886 predicted 4143
11 SASI_Mm01_00185525 predicted 1332
12 SASI_Mm01_00185528 predicted 4656
13 SASI_Mm01_00185531 predicted 3779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000052
VALIDATED
ATP7A MISSION shRNA Bacterial Glycerol Stock
ATPase, Cu++ transporting, alpha polypeptide
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-1882s21c1
Sequence:CCGGGTGTGCCTCCTGCGTACATAACTCGAGTTATGTACGCAGGAGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-748s21c1
Sequence:CCGGGCAAGGTGTTCAGCGAATTAACTCGAGTTAATTCGCTGAACACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-2476s21c1
Sequence:CCGGAGCCAAAGTGAACCCTATTACCTCGAGGTAATAGGGTTCACTTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000052.4-4671s21c1
Sequence:CCGGTGGAGAGTGCTGCCAGTTTAACTCGAGTTAAACTGGCAGCACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000052.4-4781s21c1
Sequence:CCGGTTCTATTTGAGTTGCGTTTATCTCGAGATAAACGCAACTCAAATAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-907s21c1
Sequence:CCGGTATTGATGTAGAACGTCTAAACTCGAGTTTAGACGTTCTACATCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-4213s21c1
Sequence:CCGGAGTCAAGAGGATTCGGATAAACTCGAGTTTATCCGAATCCTCTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-371s21c1
Sequence:CCGGTTTGATGCTGTTATCCATAATCTCGAGATTATGGATAACAGCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-258s21c1
Sequence:CCGGTGAATGGTGTGCATCACATTACTCGAGTAATGTGATGCACACCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-3001s1c1
Sequence:CCGGCCTCTTGGTATGGATTGTAATCTCGAGATTACAATCCATACCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000052.1-691s1c1
Sequence:CCGGCCATTCATGTACTAGCACTATCTCGAGATAGTGCTAGTACATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-4560s1c1
Sequence:CCGGGCTCCCTAAACAGTGTTGTTACTCGAGTAACAACACTGTTTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-1528s1c1
Sequence:CCGGGCCGCTTCTGACTTCAACTAACTCGAGTTAGTTGAAGTCAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-3782s1c1
Sequence:CCGGGCTGTATTAGTAGCAGTTGATCTCGAGATCAACTGCTACTAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000052
VALIDATED
ATP7A MISSION shRNA shRNA Plasmid DNA
ATPase, Cu++ transporting, alpha polypeptide
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-1882s21c1
Sequence:CCGGGTGTGCCTCCTGCGTACATAACTCGAGTTATGTACGCAGGAGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-748s21c1
Sequence:CCGGGCAAGGTGTTCAGCGAATTAACTCGAGTTAATTCGCTGAACACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-2476s21c1
Sequence:CCGGAGCCAAAGTGAACCCTATTACCTCGAGGTAATAGGGTTCACTTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000052.4-4671s21c1
Sequence:CCGGTGGAGAGTGCTGCCAGTTTAACTCGAGTTAAACTGGCAGCACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000052.4-4781s21c1
Sequence:CCGGTTCTATTTGAGTTGCGTTTATCTCGAGATAAACGCAACTCAAATAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-907s21c1
Sequence:CCGGTATTGATGTAGAACGTCTAAACTCGAGTTTAGACGTTCTACATCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-4213s21c1
Sequence:CCGGAGTCAAGAGGATTCGGATAAACTCGAGTTTATCCGAATCCTCTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-371s21c1
Sequence:CCGGTTTGATGCTGTTATCCATAATCTCGAGATTATGGATAACAGCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-258s21c1
Sequence:CCGGTGAATGGTGTGCATCACATTACTCGAGTAATGTGATGCACACCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-3001s1c1
Sequence:CCGGCCTCTTGGTATGGATTGTAATCTCGAGATTACAATCCATACCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000052.1-691s1c1
Sequence:CCGGCCATTCATGTACTAGCACTATCTCGAGATAGTGCTAGTACATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-4560s1c1
Sequence:CCGGGCTCCCTAAACAGTGTTGTTACTCGAGTAACAACACTGTTTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-1528s1c1
Sequence:CCGGGCCGCTTCTGACTTCAACTAACTCGAGTTAGTTGAAGTCAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-3782s1c1
Sequence:CCGGGCTGTATTAGTAGCAGTTGATCTCGAGATCAACTGCTACTAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000052
VALIDATED
ATP7A MISSION shRNA Lentiviral Transduction Particles
ATPase, Cu++ transporting, alpha polypeptide
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-1882s21c1
Sequence:CCGGGTGTGCCTCCTGCGTACATAACTCGAGTTATGTACGCAGGAGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-748s21c1
Sequence:CCGGGCAAGGTGTTCAGCGAATTAACTCGAGTTAATTCGCTGAACACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-2476s21c1
Sequence:CCGGAGCCAAAGTGAACCCTATTACCTCGAGGTAATAGGGTTCACTTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000052.4-4671s21c1
Sequence:CCGGTGGAGAGTGCTGCCAGTTTAACTCGAGTTAAACTGGCAGCACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000052.4-4781s21c1
Sequence:CCGGTTCTATTTGAGTTGCGTTTATCTCGAGATAAACGCAACTCAAATAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-907s21c1
Sequence:CCGGTATTGATGTAGAACGTCTAAACTCGAGTTTAGACGTTCTACATCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-4213s21c1
Sequence:CCGGAGTCAAGAGGATTCGGATAAACTCGAGTTTATCCGAATCCTCTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-371s21c1
Sequence:CCGGTTTGATGCTGTTATCCATAATCTCGAGATTATGGATAACAGCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000052.4-258s21c1
Sequence:CCGGTGAATGGTGTGCATCACATTACTCGAGTAATGTGATGCACACCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-3001s1c1
Sequence:CCGGCCTCTTGGTATGGATTGTAATCTCGAGATTACAATCCATACCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000052.1-691s1c1
Sequence:CCGGCCATTCATGTACTAGCACTATCTCGAGATAGTGCTAGTACATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-4560s1c1
Sequence:CCGGGCTCCCTAAACAGTGTTGTTACTCGAGTAACAACACTGTTTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-1528s1c1
Sequence:CCGGGCCGCTTCTGACTTCAACTAACTCGAGTTAGTTGAAGTCAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000052.1-3782s1c1
Sequence:CCGGGCTGTATTAGTAGCAGTTGATCTCGAGATCAACTGCTACTAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009726
VALIDATED
ATP7A MISSION shRNA Bacterial Glycerol Stock
ATPase, Cu++ transporting, alpha polypeptide
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-1515s21c1
Sequence:CCGGCCCTCAAGTAATGAGCTAGAACTCGAGTTCTAGCTCATTACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-1711s21c1
Sequence:CCGGCCCGAGTGATAGCAGAGTTTACTCGAGTAAACTCTGCTATCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-192s21c1
Sequence:CCGGCGGACCATTGAACAGCAGATTCTCGAGAATCTGCTGTTCAATGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-2674s21c1
Sequence:CCGGGCCGTGTTATTGAAGGACATTCTCGAGAATGTCCTTCAATAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009726.2-4653s1c1
Sequence:CCGGCGTGCAAGGATCTTATGTCAACTCGAGTTGACATAAGATCCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009726.2-152s1c1
Sequence:CCGGCGGACCATTGAACAGCAGATTCTCGAGAATCTGCTGTTCAATGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009726.2-1671s1c1
Sequence:CCGGCCCGAGTGATAGCAGAGTTTACTCGAGTAAACTCTGCTATCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009726.2-1475s1c1
Sequence:CCGGCCCTCAAGTAATGAGCTAGAACTCGAGTTCTAGCTCATTACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009726.2-2634s1c1
Sequence:CCGGGCCGTGTTATTGAAGGACATTCTCGAGAATGTCCTTCAATAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009726
VALIDATED
ATP7A MISSION shRNA shRNA Plasmid DNA
ATPase, Cu++ transporting, alpha polypeptide
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-1515s21c1
Sequence:CCGGCCCTCAAGTAATGAGCTAGAACTCGAGTTCTAGCTCATTACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-1711s21c1
Sequence:CCGGCCCGAGTGATAGCAGAGTTTACTCGAGTAAACTCTGCTATCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-192s21c1
Sequence:CCGGCGGACCATTGAACAGCAGATTCTCGAGAATCTGCTGTTCAATGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-2674s21c1
Sequence:CCGGGCCGTGTTATTGAAGGACATTCTCGAGAATGTCCTTCAATAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009726.2-4653s1c1
Sequence:CCGGCGTGCAAGGATCTTATGTCAACTCGAGTTGACATAAGATCCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009726.2-152s1c1
Sequence:CCGGCGGACCATTGAACAGCAGATTCTCGAGAATCTGCTGTTCAATGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009726.2-1671s1c1
Sequence:CCGGCCCGAGTGATAGCAGAGTTTACTCGAGTAAACTCTGCTATCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009726.2-1475s1c1
Sequence:CCGGCCCTCAAGTAATGAGCTAGAACTCGAGTTCTAGCTCATTACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009726.2-2634s1c1
Sequence:CCGGGCCGTGTTATTGAAGGACATTCTCGAGAATGTCCTTCAATAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009726
VALIDATED
ATP7A MISSION shRNA Lentiviral Transduction Particles
ATPase, Cu++ transporting, alpha polypeptide
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-1515s21c1
Sequence:CCGGCCCTCAAGTAATGAGCTAGAACTCGAGTTCTAGCTCATTACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-1711s21c1
Sequence:CCGGCCCGAGTGATAGCAGAGTTTACTCGAGTAAACTCTGCTATCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-192s21c1
Sequence:CCGGCGGACCATTGAACAGCAGATTCTCGAGAATCTGCTGTTCAATGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009726.4-2674s21c1
Sequence:CCGGGCCGTGTTATTGAAGGACATTCTCGAGAATGTCCTTCAATAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009726.2-4653s1c1
Sequence:CCGGCGTGCAAGGATCTTATGTCAACTCGAGTTGACATAAGATCCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009726.2-152s1c1
Sequence:CCGGCGGACCATTGAACAGCAGATTCTCGAGAATCTGCTGTTCAATGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009726.2-1671s1c1
Sequence:CCGGCCCGAGTGATAGCAGAGTTTACTCGAGTAAACTCTGCTATCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009726.2-1475s1c1
Sequence:CCGGCCCTCAAGTAATGAGCTAGAACTCGAGTTCTAGCTCATTACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009726.2-2634s1c1
Sequence:CCGGGCCGTGTTATTGAAGGACATTCTCGAGAATGTCCTTCAATAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks