EMAIL THIS PAGE TO A FRIEND

ATP7B

ATPase, Cu++ transporting, beta polypeptide

96 Gene Product Result for
Synonyms: PWD WC1 WD WND
UniProtKB ID: P35670, Q16318, Q16319, Q4U3V3, Q59FJ9, Q5T7X7
Gene ID:
Human(540) Summary: This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
Mouse(11979) ATPase, Cu++ transporting, beta polypeptide
Rat(24218) ATPase, Cu++ transporting, beta polypeptide
naked mole-rat(101712944) ATPase, Cu++ transporting, beta polypeptide
domestic guinea pig(100723125) ATPase, Cu++ transporting, beta polypeptide
sheep(443046) ATPase, Cu++ transporting, beta polypeptide
Domestic Rabbit(100344865) ATPase, Cu++ transporting, beta polypeptide
Zebrafish(556499) ATPase, Cu++ transporting, beta polypeptide (Wilson disease)
dog(476903) ATPase, Cu++ transporting, beta polypeptide
cow(518075) ATPase, Cu++ transporting, beta polypeptide
Horse(100052751) ATPase, Cu++ transporting, beta polypeptide
domestic cat(101091495) ATPase, Cu++ transporting, beta polypeptide
chicken(418879) ATPase, Cu++ transporting, beta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA013187 Anti-ATP7B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA009137 Anti-ATP7B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4502224 Anti-ATP7B, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry pricing
WH0000540M1 Monoclonal Anti-ATP7B antibody produced in mouse clone 3E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403592 Monoclonal Anti-ATP7B, (C-terminal) antibody produced in mouse clone 3A12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5200357 Monoclonal Anti-Copper Transporting Atpase 2 - Alkaline Phosphatase antibody produced in mouse clone S62-29, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200358 Monoclonal Anti-Copper Transporting Atpase 2 - Apc antibody produced in mouse clone S62-29, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200349 Monoclonal Anti-Copper Transporting Atpase 2 - Atto 390 antibody produced in mouse clone S62-29, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200350 Monoclonal Anti-Copper Transporting Atpase 2 - Atto 488 antibody produced in mouse clone S62-29, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200351 Monoclonal Anti-Copper Transporting Atpase 2 - Atto 565 antibody produced in mouse clone S62-29, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200352 Monoclonal Anti-Copper Transporting Atpase 2 - Atto 594 antibody produced in mouse clone S62-29, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200353 Monoclonal Anti-Copper Transporting Atpase 2 - Atto 633 antibody produced in mouse clone S62-29, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200354 Monoclonal Anti-Copper Transporting Atpase 2 - Atto 655 antibody produced in mouse clone S62-29, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200355 Monoclonal Anti-Copper Transporting Atpase 2 - Atto 680 antibody produced in mouse clone S62-29, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200356 Monoclonal Anti-Copper Transporting Atpase 2 - Atto 700 antibody produced in mouse clone S62-29, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200359 Monoclonal Anti-Copper Transporting Atpase 2 - Biotin antibody produced in mouse clone S62-29, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200360 Monoclonal Anti-Copper Transporting Atpase 2 - Fitc antibody produced in mouse clone S62-29, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200361 Monoclonal Anti-Copper Transporting Atpase 2 - Hrp antibody produced in mouse clone S62-29, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200362 Monoclonal Anti-Copper Transporting Atpase 2 - Pe/Atto 594 antibody produced in mouse clone S62-29, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200363 Monoclonal Anti-Copper Transporting Atpase 2 - Percp antibody produced in mouse clone S62-29, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200364 Monoclonal Anti-Copper Transporting Atpase 2 - Rpe antibody produced in mouse clone S62-29, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200365 Monoclonal Anti-Copper Transporting Atpase 2 - Streptavidin antibody produced in mouse clone S62-29, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200348 Monoclonal Anti-Copper Transporting Atpase 2 antibody produced in mouse clone S62-29, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000053 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000053 Rosetta Predictions human pricing
NM_001005918 Rosetta Predictions human pricing
NM_012511 Rosetta Predictions rat pricing
NM_007511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192075 predicted 821
2 SASI_Hs01_00192076 predicted 3381
3 SASI_Hs01_00192077 predicted 957
4 SASI_Hs01_00192078 predicted 831
5 SASI_Hs01_00192079 predicted 800
6 SASI_Hs01_00192080 predicted 1160
7 SASI_Hs01_00192081 predicted 1038
8 SASI_Hs01_00192082 predicted 3450
9 SASI_Hs02_00301759 predicted 4178
10 SASI_Hs02_00301760 predicted 4078
11 SASI_Hs01_00192074 predicted 1482
12 SASI_Hs01_00192083 predicted 4064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128509 predicted 823
2 SASI_Hs01_00128510 predicted 2761
3 SASI_Hs01_00128511 predicted 957
4 SASI_Hs01_00128512 predicted 829
5 SASI_Hs01_00128513 predicted 798
6 SASI_Hs01_00128514 predicted 1163
7 SASI_Hs01_00128515 predicted 1041
8 SASI_Hs01_00128516 predicted 2832
9 SASI_Hs02_00305054 predicted 3558
10 SASI_Hs02_00305055 predicted 3459
11 SASI_Hs01_00128508 predicted 1482
12 SASI_Hs01_00128517 predicted 3440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060310 predicted 1793
2 SASI_Rn02_00259563 predicted 2591
3 SASI_Rn01_00060311 predicted 639
4 SASI_Rn01_00060313 predicted 891
5 SASI_Rn01_00060314 predicted 526
6 SASI_Rn02_00259564 predicted 2650
7 SASI_Rn01_00060315 predicted 1733
8 SASI_Rn02_00259565 predicted 1721
9 SASI_Rn01_00060316 predicted 1679
10 SASI_Rn01_00060317 predicted 563
11 SASI_Rn01_00060312 predicted 2764
12 SASI_Rn01_00060318 predicted 2689
13 SASI_Rn01_00060319 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024833 predicted 2637
2 SASI_Mm01_00024834 predicted 2015
3 SASI_Mm01_00024835 predicted 2563
4 SASI_Mm01_00024836 predicted 695
5 SASI_Mm01_00024837 predicted 2837
6 SASI_Mm01_00024838 predicted 724
7 SASI_Mm01_00024839 predicted 1783
8 SASI_Mm01_00024840 predicted 1717
9 SASI_Mm02_00311805 predicted 2755
10 SASI_Mm01_00024841 predicted 1312
11 SASI_Mm01_00024832 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000053
VALIDATED
ATP7B MISSION shRNA Bacterial Glycerol Stock
ATPase, Cu++ transporting, beta polypeptide
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000053.1-2771s1c1
Sequence:CCGGGCACTGTAATTGCGAGGTCTACTCGAGTAGACCTCGCAATTACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000053.1-960s1c1
Sequence:CCGGGCATTGTAAGTCTTGCGTCTTCTCGAGAAGACGCAAGACTTACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000053.1-4275s1c1
Sequence:CCGGGCAGCTCAAGTGCTATAAGAACTCGAGTTCTTATAGCACTTGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000053.1-2464s1c1
Sequence:CCGGCCCATGCTCTTTGTGTTCATTCTCGAGAATGAACACAAAGAGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2794s21c1
Sequence:CCGGACATGGCTCTGTGCTCATTAACTCGAGTTAATGAGCACAGAGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2908s21c1
Sequence:CCGGTGACCGGTTTAGTGGATATTTCTCGAGAAATATCCACTAAACCGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2298s21c1
Sequence:CCGGTCTACGTTCAGGCCTACAAATCTCGAGATTTGTAGGCCTGAACGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000053.2-4853s21c1
Sequence:CCGGGACCTCTGCTTGGAGTATTTACTCGAGTAAATACTCCAAGCAGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000053.2-1992s21c1
Sequence:CCGGTTATCGGTCCACGGGATATTACTCGAGTAATATCCCGTGGACCGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2149s21c1
Sequence:CCGGCATGGCCTTAATGATCTATATCTCGAGATATAGATCATTAAGGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000053.2-955s21c1
Sequence:CCGGGCATTGTAAGTCTTGCGTCTTCTCGAGAAGACGCAAGACTTACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000053
VALIDATED
ATP7B MISSION shRNA shRNA Plasmid DNA
ATPase, Cu++ transporting, beta polypeptide
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000053.1-2771s1c1
Sequence:CCGGGCACTGTAATTGCGAGGTCTACTCGAGTAGACCTCGCAATTACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000053.1-960s1c1
Sequence:CCGGGCATTGTAAGTCTTGCGTCTTCTCGAGAAGACGCAAGACTTACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000053.1-4275s1c1
Sequence:CCGGGCAGCTCAAGTGCTATAAGAACTCGAGTTCTTATAGCACTTGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000053.1-2464s1c1
Sequence:CCGGCCCATGCTCTTTGTGTTCATTCTCGAGAATGAACACAAAGAGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2794s21c1
Sequence:CCGGACATGGCTCTGTGCTCATTAACTCGAGTTAATGAGCACAGAGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2908s21c1
Sequence:CCGGTGACCGGTTTAGTGGATATTTCTCGAGAAATATCCACTAAACCGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2298s21c1
Sequence:CCGGTCTACGTTCAGGCCTACAAATCTCGAGATTTGTAGGCCTGAACGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000053.2-4853s21c1
Sequence:CCGGGACCTCTGCTTGGAGTATTTACTCGAGTAAATACTCCAAGCAGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000053.2-1992s21c1
Sequence:CCGGTTATCGGTCCACGGGATATTACTCGAGTAATATCCCGTGGACCGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2149s21c1
Sequence:CCGGCATGGCCTTAATGATCTATATCTCGAGATATAGATCATTAAGGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000053.2-955s21c1
Sequence:CCGGGCATTGTAAGTCTTGCGTCTTCTCGAGAAGACGCAAGACTTACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000053
VALIDATED
ATP7B MISSION shRNA Lentiviral Transduction Particles
ATPase, Cu++ transporting, beta polypeptide
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000053.1-2771s1c1
Sequence:CCGGGCACTGTAATTGCGAGGTCTACTCGAGTAGACCTCGCAATTACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000053.1-960s1c1
Sequence:CCGGGCATTGTAAGTCTTGCGTCTTCTCGAGAAGACGCAAGACTTACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000053.1-4275s1c1
Sequence:CCGGGCAGCTCAAGTGCTATAAGAACTCGAGTTCTTATAGCACTTGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000053.1-2464s1c1
Sequence:CCGGCCCATGCTCTTTGTGTTCATTCTCGAGAATGAACACAAAGAGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2794s21c1
Sequence:CCGGACATGGCTCTGTGCTCATTAACTCGAGTTAATGAGCACAGAGCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2908s21c1
Sequence:CCGGTGACCGGTTTAGTGGATATTTCTCGAGAAATATCCACTAAACCGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2298s21c1
Sequence:CCGGTCTACGTTCAGGCCTACAAATCTCGAGATTTGTAGGCCTGAACGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000053.2-4853s21c1
Sequence:CCGGGACCTCTGCTTGGAGTATTTACTCGAGTAAATACTCCAAGCAGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000053.2-1992s21c1
Sequence:CCGGTTATCGGTCCACGGGATATTACTCGAGTAATATCCCGTGGACCGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000053.2-2149s21c1
Sequence:CCGGCATGGCCTTAATGATCTATATCTCGAGATATAGATCATTAAGGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000053.2-955s21c1
Sequence:CCGGGCATTGTAAGTCTTGCGTCTTCTCGAGAAGACGCAAGACTTACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007511
ATP7B MISSION shRNA Bacterial Glycerol Stock
ATPase, Cu++ transporting, beta polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007511.1-4693s1c1
Sequence:CCGGGCCTTACAGTGTGTGGTGTATCTCGAGATACACCACACACTGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-1670s1c1
Sequence:CCGGCCTGTGTGTCTAACATAGAAACTCGAGTTTCTATGTTAGACACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-2777s1c1
Sequence:CCGGGCATAGTGATTGCTGGCTCTACTCGAGTAGAGCCAGCAATCACTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-3388s1c1
Sequence:CCGGGCCGTCACTAAATACTGCAAACTCGAGTTTGCAGTATTTAGTGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-969s1c1
Sequence:CCGGCCCACTAAGAATAGACGGCATCTCGAGATGCCGTCTATTCTTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007511
ATP7B MISSION shRNA shRNA Plasmid DNA
ATPase, Cu++ transporting, beta polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007511.1-4693s1c1
Sequence:CCGGGCCTTACAGTGTGTGGTGTATCTCGAGATACACCACACACTGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-1670s1c1
Sequence:CCGGCCTGTGTGTCTAACATAGAAACTCGAGTTTCTATGTTAGACACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-2777s1c1
Sequence:CCGGGCATAGTGATTGCTGGCTCTACTCGAGTAGAGCCAGCAATCACTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-3388s1c1
Sequence:CCGGGCCGTCACTAAATACTGCAAACTCGAGTTTGCAGTATTTAGTGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-969s1c1
Sequence:CCGGCCCACTAAGAATAGACGGCATCTCGAGATGCCGTCTATTCTTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007511
ATP7B MISSION shRNA Lentiviral Transduction Particles
ATPase, Cu++ transporting, beta polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007511.1-4693s1c1
Sequence:CCGGGCCTTACAGTGTGTGGTGTATCTCGAGATACACCACACACTGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-1670s1c1
Sequence:CCGGCCTGTGTGTCTAACATAGAAACTCGAGTTTCTATGTTAGACACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-2777s1c1
Sequence:CCGGGCATAGTGATTGCTGGCTCTACTCGAGTAGAGCCAGCAATCACTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-3388s1c1
Sequence:CCGGGCCGTCACTAAATACTGCAAACTCGAGTTTGCAGTATTTAGTGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007511.1-969s1c1
Sequence:CCGGCCCACTAAGAATAGACGGCATCTCGAGATGCCGTCTATTCTTAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)