EMAIL THIS PAGE TO A FRIEND

ATP8A1

ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1

112 Gene Product Result for
Synonyms: ATPASEII ATPIA ATPP2
UniProtKB ID: Q9Y2Q0, Q32M35, Q32M36, Q4W5J7, Q4W5P2
Gene ID:
Human(10396) Summary: The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11980) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Rat(289615) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
naked mole-rat(101725406) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
domestic guinea pig(100717564) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
sheep(101119308) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Domestic Rabbit(100355104) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Zebrafish(767630) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Zebrafish(100333061) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
cow(317692) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Horse(100062902) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
domestic cat(101091868) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
dog(607976) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
chicken(422776) ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006095 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069321 MISSION® esiRNA esiRNA human ATP8A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105529 Rosetta Predictions human pricing
NM_006095 Rosetta Predictions human pricing
XM_001070245 Rosetta Predictions rat pricing
XM_223390 Rosetta Predictions rat pricing
NM_001038999 Rosetta Predictions mouse pricing
NM_009727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324211 predicted 1910
2 SASI_Hs02_00324212 predicted 3397
3 SASI_Hs02_00324213 predicted 2256
4 SASI_Hs02_00324214 predicted 2424
5 SASI_Hs02_00324215 predicted 3173
6 SASI_Hs02_00324216 predicted 2859
7 SASI_Hs02_00324217 predicted 3640
8 SASI_Hs02_00324218 predicted 2492
9 SASI_Hs02_00324219 predicted 2058
10 SASI_Hs02_00324220 predicted 2247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019404 predicted 1955
2 SASI_Hs01_00019405 predicted 3439
3 SASI_Hs01_00019407 predicted 2301
4 SASI_Hs02_00340876 predicted 2474
5 SASI_Hs01_00019408 predicted 3215
6 SASI_Hs01_00019409 predicted 2903
7 SASI_Hs01_00019410 predicted 3684
8 SASI_Hs01_00019411 predicted 2535
9 SASI_Hs02_00340877 predicted 2104
10 SASI_Hs02_00340878 predicted 2286
11 SASI_Hs01_00019402 predicted 1639
12 SASI_Hs01_00019403 predicted 1615
13 SASI_Hs01_00019406 predicted 2600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330981 predicted 1908
2 SASI_Rn02_00330982 predicted 2169
3 SASI_Rn02_00330983 predicted 1620
4 SASI_Rn02_00330984 predicted 1201
5 SASI_Rn02_00330985 predicted 843
6 SASI_Rn02_00330986 predicted 1394
7 SASI_Rn02_00330987 predicted 414
8 SASI_Rn02_00330988 predicted 536
9 SASI_Rn02_00330989 predicted 2323
10 SASI_Rn02_00330990 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381315 predicted 1914
2 SASI_Rn02_00381316 predicted 2170
3 SASI_Rn02_00381317 predicted 1617
4 SASI_Rn02_00381318 predicted 1194
5 SASI_Rn02_00381319 predicted 839
6 SASI_Rn02_00381320 predicted 1397
7 SASI_Rn02_00381321 predicted 418
8 SASI_Rn02_00381322 predicted 537
9 SASI_Rn02_00381323 predicted 253
10 SASI_Rn02_00381324 predicted 2322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123808 predicted 2703
2 SASI_Mm01_00123809 predicted 2524
3 SASI_Mm02_00289723 predicted 3544
4 SASI_Mm01_00123810 predicted 2358
5 SASI_Mm01_00123811 predicted 2222
6 SASI_Mm01_00123812 predicted 2339
7 SASI_Mm01_00123814 predicted 3156
8 SASI_Mm01_00123815 predicted 269
9 SASI_Mm01_00123816 predicted 1083
10 SASI_Mm01_00123817 predicted 3676
11 SASI_Mm01_00123813 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050345 predicted 2660
2 SASI_Mm01_00050346 predicted 2477
3 SASI_Mm02_00316887 predicted 3500
4 SASI_Mm01_00050347 predicted 2315
5 SASI_Mm01_00050348 predicted 2171
6 SASI_Mm01_00050349 predicted 2293
7 SASI_Mm01_00050351 predicted 3108
8 SASI_Mm01_00050352 predicted 272
9 SASI_Mm01_00050353 predicted 1079
10 SASI_Mm01_00050354 predicted 3626
11 SASI_Mm01_00050350 predicted 331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006095
ATP8A1 MISSION shRNA Bacterial Glycerol Stock
ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006095.2-1808s21c1
Sequence:CCGGACACCCGACTCGGTGATTATACTCGAGTATAATCACCGAGTCGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006095.2-4077s21c1
Sequence:CCGGACAAGGTAACCAACCATTAAACTCGAGTTTAATGGTTGGTTACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006095.2-1231s21c1
Sequence:CCGGCTATGGTGGCGCTAGTAATTTCTCGAGAAATTACTAGCGCCACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-2709s1c1
Sequence:CCGGGCCTCCTTTAACTCTTGGAATCTCGAGATTCCAAGAGTTAAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-1106s1c1
Sequence:CCGGCCCAGGCATACTTCATAAATTCTCGAGAATTTATGAAGTATGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-858s1c1
Sequence:CCGGGCTCTCAAATGTGGAACGGATCTCGAGATCCGTTCCACATTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-2272s1c1
Sequence:CCGGCGACAGTATTTCCTGGACTTACTCGAGTAAGTCCAGGAAATACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-1920s1c1
Sequence:CCGGCGAAGAGAGTTATGAGTTGATCTCGAGATCAACTCATAACTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006095
ATP8A1 MISSION shRNA shRNA Plasmid DNA
ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006095.2-1808s21c1
Sequence:CCGGACACCCGACTCGGTGATTATACTCGAGTATAATCACCGAGTCGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006095.2-4077s21c1
Sequence:CCGGACAAGGTAACCAACCATTAAACTCGAGTTTAATGGTTGGTTACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006095.2-1231s21c1
Sequence:CCGGCTATGGTGGCGCTAGTAATTTCTCGAGAAATTACTAGCGCCACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-2709s1c1
Sequence:CCGGGCCTCCTTTAACTCTTGGAATCTCGAGATTCCAAGAGTTAAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-1106s1c1
Sequence:CCGGCCCAGGCATACTTCATAAATTCTCGAGAATTTATGAAGTATGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-858s1c1
Sequence:CCGGGCTCTCAAATGTGGAACGGATCTCGAGATCCGTTCCACATTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-2272s1c1
Sequence:CCGGCGACAGTATTTCCTGGACTTACTCGAGTAAGTCCAGGAAATACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-1920s1c1
Sequence:CCGGCGAAGAGAGTTATGAGTTGATCTCGAGATCAACTCATAACTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006095
ATP8A1 MISSION shRNA Lentiviral Transduction Particles
ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006095.2-1808s21c1
Sequence:CCGGACACCCGACTCGGTGATTATACTCGAGTATAATCACCGAGTCGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006095.2-4077s21c1
Sequence:CCGGACAAGGTAACCAACCATTAAACTCGAGTTTAATGGTTGGTTACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006095.2-1231s21c1
Sequence:CCGGCTATGGTGGCGCTAGTAATTTCTCGAGAAATTACTAGCGCCACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-2709s1c1
Sequence:CCGGGCCTCCTTTAACTCTTGGAATCTCGAGATTCCAAGAGTTAAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-1106s1c1
Sequence:CCGGCCCAGGCATACTTCATAAATTCTCGAGAATTTATGAAGTATGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-858s1c1
Sequence:CCGGGCTCTCAAATGTGGAACGGATCTCGAGATCCGTTCCACATTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-2272s1c1
Sequence:CCGGCGACAGTATTTCCTGGACTTACTCGAGTAAGTCCAGGAAATACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006095.1-1920s1c1
Sequence:CCGGCGAAGAGAGTTATGAGTTGATCTCGAGATCAACTCATAACTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009727
VALIDATED
ATP8A1 MISSION shRNA Bacterial Glycerol Stock
ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009727.1-2227s1c1
Sequence:CCGGCGGCAGTATTTCCTGGACTTACTCGAGTAAGTCCAGGAAATACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009727.1-1374s1c1
Sequence:CCGGCGCACCTATCATCTGTGAATTCTCGAGAATTCACAGATGATAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009727.1-3279s1c1
Sequence:CCGGGCTGCTCAAGAACGTCTTTAACTCGAGTTAAAGACGTTCTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009727.1-557s1c1
Sequence:CCGGCCAACTTAGATGGTGAAACAACTCGAGTTGTTTCACCATCTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009727.1-1008s1c1
Sequence:CCGGCGCTAGTAACTTTGGACTGAACTCGAGTTCAGTCCAAAGTTACTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009727
VALIDATED
ATP8A1 MISSION shRNA shRNA Plasmid DNA
ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009727.1-2227s1c1
Sequence:CCGGCGGCAGTATTTCCTGGACTTACTCGAGTAAGTCCAGGAAATACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009727.1-1374s1c1
Sequence:CCGGCGCACCTATCATCTGTGAATTCTCGAGAATTCACAGATGATAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009727.1-3279s1c1
Sequence:CCGGGCTGCTCAAGAACGTCTTTAACTCGAGTTAAAGACGTTCTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009727.1-557s1c1
Sequence:CCGGCCAACTTAGATGGTGAAACAACTCGAGTTGTTTCACCATCTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009727.1-1008s1c1
Sequence:CCGGCGCTAGTAACTTTGGACTGAACTCGAGTTCAGTCCAAAGTTACTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009727
VALIDATED
ATP8A1 MISSION shRNA Lentiviral Transduction Particles
ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009727.1-2227s1c1
Sequence:CCGGCGGCAGTATTTCCTGGACTTACTCGAGTAAGTCCAGGAAATACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009727.1-1374s1c1
Sequence:CCGGCGCACCTATCATCTGTGAATTCTCGAGAATTCACAGATGATAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009727.1-3279s1c1
Sequence:CCGGGCTGCTCAAGAACGTCTTTAACTCGAGTTAAAGACGTTCTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009727.1-557s1c1
Sequence:CCGGCCAACTTAGATGGTGAAACAACTCGAGTTGTTTCACCATCTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009727.1-1008s1c1
Sequence:CCGGCGCTAGTAACTTTGGACTGAACTCGAGTTCAGTCCAAAGTTACTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks