EMAIL THIS PAGE TO A FRIEND

ATP8A2

ATPase, aminophospholipid transporter, class I, type 8A, member 2

75 Gene Product Result for
Synonyms: ATP ATPIB CAMRQ4 IB ML-1
UniProtKB ID: Q9NTI2, Q9H527, Q9NPU6, Q9NTL2, Q9NYM3
Gene ID:
Mouse(50769) ATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Zebrafish(100330943) ATPase, aminophospholipid transporter-like, class I, type 8A, member 2
cow(508723) ATPase, aminophospholipid transporter, class I, type 8A, member 2
cow(617199) ATPase, aminophospholipid transporter, class I, type 8A, member 2
Horse(100059537) ATPase, aminophospholipid transporter, class I, type 8A, member 2
Horse(100059750) ATPase, aminophospholipid transporter, class I, type 8A, member 2
domestic cat(101085594) ATPase, aminophospholipid transporter, class I, type 8A, member 2
dog(100687016) ATPase, aminophospholipid transporter, class I, type 8A, member 2
chicken(418936) ATPase, aminophospholipid transporter, class I, type 8A, member 2
sheep(101115632) ATPase, aminophospholipid transporter, class I, type 8A, member 2
domestic guinea pig(100729844) ATPase, aminophospholipid transporter, class I, type 8A, member 2
naked mole-rat(101721978) ATPase, aminophospholipid transporter, class I, type 8A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016529 Rosetta Predictions human pricing
NM_015803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151699 predicted 1242
2 SASI_Hs01_00151700 predicted 3301
3 SASI_Hs02_00349631 predicted 2311
4 SASI_Hs01_00151704 predicted 2799
5 SASI_Hs01_00151705 predicted 3089
6 SASI_Hs02_00349632 predicted 2267
7 SASI_Hs01_00151706 predicted 3366
8 SASI_Hs01_00151707 predicted 986
9 SASI_Hs02_00349633 predicted 386
10 SASI_Hs02_00349634 predicted 3123
11 SASI_Hs01_00151701 predicted 2475
12 SASI_Hs01_00151702 predicted 1870
13 SASI_Hs01_00151703 predicted 1121
14 SASI_Hs01_00151708 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119138 predicted 3233
2 SASI_Mm01_00119140 predicted 2278
3 SASI_Mm02_00323183 predicted 2201
4 SASI_Mm02_00323184 predicted 1703
5 SASI_Mm01_00119143 predicted 3032
6 SASI_Mm01_00119144 predicted 714
7 SASI_Mm01_00119145 predicted 280
8 SASI_Mm01_00119146 predicted 2562
9 SASI_Mm01_00119147 predicted 2579
10 SASI_Mm02_00323185 predicted 3357
11 SASI_Mm01_00119139 predicted 1332
12 SASI_Mm01_00119141 predicted 3199
13 SASI_Mm01_00119142 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016529
ATP8A2 MISSION shRNA Bacterial Glycerol Stock
ATPase, aminophospholipid transporter, class I, type 8A, member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-2446s1c1
Sequence:CCGGCCGACTATTTATTTGTTGGAACTCGAGTTCCAACAAATAAATAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-2526s1c1
Sequence:CCGGGCTTGGACTAAATTCAGTCATCTCGAGATGACTGAATTTAGTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-828s1c1
Sequence:CCGGGCGCCTCTCAAGAGATCAAATCTCGAGATTTGATCTCTTGAGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-1262s1c1
Sequence:CCGGCGGAGTAACCTATGGTCACTTCTCGAGAAGTGACCATAGGTTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-180s1c1
Sequence:CCGGCGATTCTTGTATGAGCAGATTCTCGAGAATCTGCTCATACAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016529.4-2499s21c1
Sequence:CCGGTCTCGTGCAAAGCGGTCATATCTCGAGATATGACCGCTTTGCACGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016529
ATP8A2 MISSION shRNA shRNA Plasmid DNA
ATPase, aminophospholipid transporter, class I, type 8A, member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-2446s1c1
Sequence:CCGGCCGACTATTTATTTGTTGGAACTCGAGTTCCAACAAATAAATAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-2526s1c1
Sequence:CCGGGCTTGGACTAAATTCAGTCATCTCGAGATGACTGAATTTAGTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-828s1c1
Sequence:CCGGGCGCCTCTCAAGAGATCAAATCTCGAGATTTGATCTCTTGAGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-1262s1c1
Sequence:CCGGCGGAGTAACCTATGGTCACTTCTCGAGAAGTGACCATAGGTTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-180s1c1
Sequence:CCGGCGATTCTTGTATGAGCAGATTCTCGAGAATCTGCTCATACAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016529.4-2499s21c1
Sequence:CCGGTCTCGTGCAAAGCGGTCATATCTCGAGATATGACCGCTTTGCACGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016529
ATP8A2 MISSION shRNA Lentiviral Transduction Particles
ATPase, aminophospholipid transporter, class I, type 8A, member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-2446s1c1
Sequence:CCGGCCGACTATTTATTTGTTGGAACTCGAGTTCCAACAAATAAATAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-2526s1c1
Sequence:CCGGGCTTGGACTAAATTCAGTCATCTCGAGATGACTGAATTTAGTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-828s1c1
Sequence:CCGGGCGCCTCTCAAGAGATCAAATCTCGAGATTTGATCTCTTGAGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-1262s1c1
Sequence:CCGGCGGAGTAACCTATGGTCACTTCTCGAGAAGTGACCATAGGTTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016529.3-180s1c1
Sequence:CCGGCGATTCTTGTATGAGCAGATTCTCGAGAATCTGCTCATACAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016529.4-2499s21c1
Sequence:CCGGTCTCGTGCAAAGCGGTCATATCTCGAGATATGACCGCTTTGCACGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015803
ATP8A2 MISSION shRNA Bacterial Glycerol Stock
ATPase, aminophospholipid transporter, class I, type 8A, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-1431s1c1
Sequence:CCGGCGGATGACTTCTTGTACCAATCTCGAGATTGGTACAAGAAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-1202s1c1
Sequence:CCGGCCTCTTCATAAACTGGGACATCTCGAGATGTCCCAGTTTATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-199s1c1
Sequence:CCGGGCATAATTTACCTCAACCAATCTCGAGATTGGTTGAGGTAAATTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-2568s1c1
Sequence:CCGGGCTACCAACAACTCAGATTATCTCGAGATAATCTGAGTTGTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-198s1c1
Sequence:CCGGCGCATAATTTACCTCAACCAACTCGAGTTGGTTGAGGTAAATTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015803
ATP8A2 MISSION shRNA shRNA Plasmid DNA
ATPase, aminophospholipid transporter, class I, type 8A, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-1431s1c1
Sequence:CCGGCGGATGACTTCTTGTACCAATCTCGAGATTGGTACAAGAAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-1202s1c1
Sequence:CCGGCCTCTTCATAAACTGGGACATCTCGAGATGTCCCAGTTTATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-199s1c1
Sequence:CCGGGCATAATTTACCTCAACCAATCTCGAGATTGGTTGAGGTAAATTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-2568s1c1
Sequence:CCGGGCTACCAACAACTCAGATTATCTCGAGATAATCTGAGTTGTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-198s1c1
Sequence:CCGGCGCATAATTTACCTCAACCAACTCGAGTTGGTTGAGGTAAATTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015803
ATP8A2 MISSION shRNA Lentiviral Transduction Particles
ATPase, aminophospholipid transporter, class I, type 8A, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-1431s1c1
Sequence:CCGGCGGATGACTTCTTGTACCAATCTCGAGATTGGTACAAGAAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-1202s1c1
Sequence:CCGGCCTCTTCATAAACTGGGACATCTCGAGATGTCCCAGTTTATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-199s1c1
Sequence:CCGGGCATAATTTACCTCAACCAATCTCGAGATTGGTTGAGGTAAATTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-2568s1c1
Sequence:CCGGGCTACCAACAACTCAGATTATCTCGAGATAATCTGAGTTGTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015803.1-198s1c1
Sequence:CCGGCGCATAATTTACCTCAACCAACTCGAGTTGGTTGAGGTAAATTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks