EMAIL THIS PAGE TO A FRIEND

ATP8B1

ATPase, aminophospholipid transporter, class I, type 8B, member 1

73 Gene Product Result for
Synonyms: ATPIC BRIC FIC1 ICP1 PFIC PFIC1
UniProtKB ID: O43520, Q9BTP8
Gene ID:
Human(5205) Summary: This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
Mouse(54670) ATPase, class I, type 8B, member 1
Rat(291555) ATPase, aminophospholipid transporter, class I, type 8B, member 1
Zebrafish(100148342) ATPase, aminophospholipid transporter, class I, type 8B, member 1
chicken(426857) ATPase, class I, type 8B, member 1
dog(476190) ATPase, aminophospholipid transporter, class I, type 8B, member 1
domestic cat(101101003) ATPase, aminophospholipid transporter, class I, type 8B, member 1
Horse(100054112) ATPase, aminophospholipid transporter, class I, type 8B, member 1
cow(541187) ATPase, aminophospholipid transporter, class I, type 8B, member 1
naked mole-rat(101715035) ATPase, aminophospholipid transporter, class I, type 8B, member 1
domestic guinea pig(100730208) ATPase, aminophospholipid transporter, class I, type 8B, member 1
sheep(101115500) ATPase, aminophospholipid transporter, class I, type 8B, member 1
Domestic Rabbit(100358787) ATPase, aminophospholipid transporter, class I, type 8B, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069511 MISSION® esiRNA esiRNA targeting mouse Atp8b1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005603 Rosetta Predictions human pricing
NM_001106140 Rosetta Predictions rat pricing
NM_001001488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161145 predicted 321
2 SASI_Hs01_00161146 predicted 3253
3 SASI_Hs01_00161147 predicted 261
4 SASI_Hs02_00339916 predicted 1794
5 SASI_Hs02_00339917 predicted 294
6 SASI_Hs01_00161148 predicted 889
7 SASI_Hs01_00161149 predicted 2384
8 SASI_Hs02_00339918 predicted 3121
9 SASI_Hs01_00161151 predicted 2110
10 SASI_Hs01_00161152 predicted 287
11 SASI_Hs01_00161150 predicted 3266
12 SASI_Hs01_00161153 predicted 878
13 SASI_Hs01_00161154 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216018 predicted 1163
2 SASI_Rn02_00216019 predicted 2877
3 SASI_Rn02_00216020 predicted 266
4 SASI_Rn02_00216021 predicted 477
5 SASI_Rn02_00216022 predicted 2841
6 SASI_Rn02_00216023 predicted 1838
7 SASI_Rn02_00216024 predicted 2410
8 SASI_Rn02_00216025 predicted 655
9 SASI_Rn02_00216026 predicted 3442
10 SASI_Rn02_00216027 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054866 predicted 1487
2 SASI_Mm02_00286161 predicted 497
3 SASI_Mm01_00054867 predicted 799
4 SASI_Mm01_00054868 predicted 3580
5 SASI_Mm02_00286162 predicted 2316
6 SASI_Mm02_00286163 predicted 616
7 SASI_Mm01_00054870 predicted 1792
8 SASI_Mm01_00054872 predicted 978
9 SASI_Mm01_00054873 predicted 1842
10 SASI_Mm01_00054874 predicted 1852
11 SASI_Mm01_00054869 predicted 2159
12 SASI_Mm01_00054871 predicted 2402
13 SASI_Mm01_00054875 predicted 2211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005603
VALIDATED
ATP8B1 MISSION shRNA Bacterial Glycerol Stock
ATPase, aminophospholipid transporter, class I, type 8B, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005603.3-3913s21c1
Sequence:CCGGACAATAGCAGAGCCAAGAAATCTCGAGATTTCTTGGCTCTGCTATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-1888s21c1
Sequence:CCGGCATCGAATGAATCCTACTAAGCTCGAGCTTAGTAGGATTCATTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-347s21c1
Sequence:CCGGTTAAGAGAGCAGCCAATTTATCTCGAGATAAATTGGCTGCTCTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-1331s21c1
Sequence:CCGGAGCTCGGGCAGATCCATTATACTCGAGTATAATGGATCTGCCCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-265s21c1
Sequence:CCGGGAGAGTAAATATGCGAATAATCTCGAGATTATTCGCATATTTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005603.1-3513s1c1
Sequence:CCGGGCCATCAGAAAGTGATAAGATCTCGAGATCTTATCACTTTCTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-1798s1c1
Sequence:CCGGCGGAAGCGAATGTCTATCATTCTCGAGAATGATAGACATTCGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-2820s1c1
Sequence:CCGGCCGATGGTCTTACATAAGGATCTCGAGATCCTTATGTAAGACCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-1527s1c1
Sequence:CCGGCCACTATCTTATTGAGCAAATCTCGAGATTTGCTCAATAAGATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-3235s1c1
Sequence:CCGGGCTCTTGTAATAACAGTCAATCTCGAGATTGACTGTTATTACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005603
VALIDATED
ATP8B1 MISSION shRNA shRNA Plasmid DNA
ATPase, aminophospholipid transporter, class I, type 8B, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005603.3-3913s21c1
Sequence:CCGGACAATAGCAGAGCCAAGAAATCTCGAGATTTCTTGGCTCTGCTATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-1888s21c1
Sequence:CCGGCATCGAATGAATCCTACTAAGCTCGAGCTTAGTAGGATTCATTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-347s21c1
Sequence:CCGGTTAAGAGAGCAGCCAATTTATCTCGAGATAAATTGGCTGCTCTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-1331s21c1
Sequence:CCGGAGCTCGGGCAGATCCATTATACTCGAGTATAATGGATCTGCCCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-265s21c1
Sequence:CCGGGAGAGTAAATATGCGAATAATCTCGAGATTATTCGCATATTTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005603.1-3513s1c1
Sequence:CCGGGCCATCAGAAAGTGATAAGATCTCGAGATCTTATCACTTTCTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-1798s1c1
Sequence:CCGGCGGAAGCGAATGTCTATCATTCTCGAGAATGATAGACATTCGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-2820s1c1
Sequence:CCGGCCGATGGTCTTACATAAGGATCTCGAGATCCTTATGTAAGACCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-1527s1c1
Sequence:CCGGCCACTATCTTATTGAGCAAATCTCGAGATTTGCTCAATAAGATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-3235s1c1
Sequence:CCGGGCTCTTGTAATAACAGTCAATCTCGAGATTGACTGTTATTACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005603
VALIDATED
ATP8B1 MISSION shRNA Lentiviral Transduction Particles
ATPase, aminophospholipid transporter, class I, type 8B, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005603.3-3913s21c1
Sequence:CCGGACAATAGCAGAGCCAAGAAATCTCGAGATTTCTTGGCTCTGCTATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-1888s21c1
Sequence:CCGGCATCGAATGAATCCTACTAAGCTCGAGCTTAGTAGGATTCATTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-347s21c1
Sequence:CCGGTTAAGAGAGCAGCCAATTTATCTCGAGATAAATTGGCTGCTCTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-1331s21c1
Sequence:CCGGAGCTCGGGCAGATCCATTATACTCGAGTATAATGGATCTGCCCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005603.3-265s21c1
Sequence:CCGGGAGAGTAAATATGCGAATAATCTCGAGATTATTCGCATATTTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005603.1-3513s1c1
Sequence:CCGGGCCATCAGAAAGTGATAAGATCTCGAGATCTTATCACTTTCTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-1798s1c1
Sequence:CCGGCGGAAGCGAATGTCTATCATTCTCGAGAATGATAGACATTCGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-2820s1c1
Sequence:CCGGCCGATGGTCTTACATAAGGATCTCGAGATCCTTATGTAAGACCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-1527s1c1
Sequence:CCGGCCACTATCTTATTGAGCAAATCTCGAGATTTGCTCAATAAGATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005603.1-3235s1c1
Sequence:CCGGGCTCTTGTAATAACAGTCAATCTCGAGATTGACTGTTATTACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001488
ATP8B1 MISSION shRNA Bacterial Glycerol Stock
ATPase, aminophospholipid transporter, class I, type 8B, member 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001488.1-3873s1c1
Sequence:CCGGTCTTTAATGAACGACTCAGGACTCGAGTCCTGAGTCGTTCATTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-778s1c1
Sequence:CCGGCCTGGAAATCACGGACCAATACTCGAGTATTGGTCCGTGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-2402s1c1
Sequence:CCGGCCTCCTGTGTATGAACCCTTTCTCGAGAAAGGGTTCATACACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-1321s1c1
Sequence:CCGGGCAGATGTACTATGCTGAGAACTCGAGTTCTCAGCATAGTACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-3410s1c1
Sequence:CCGGGCTGGGATACACGTTCTCTTTCTCGAGAAAGAGAACGTGTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001488.2-4518s1c1
Sequence:CCGGGCAGTAACAAAGGGTTGCTAACTCGAGTTAGCAACCCTTTGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001488.2-4595s1c1
Sequence:CCGGCCTGTTTCTTTCTACCAACTTCTCGAGAAGTTGGTAGAAAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001488.2-588s1c1
Sequence:CCGGGAGAGCAAATATGCGAGTAATCTCGAGATTACTCGCATATTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001488
ATP8B1 MISSION shRNA shRNA Plasmid DNA
ATPase, aminophospholipid transporter, class I, type 8B, member 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001488.1-3873s1c1
Sequence:CCGGTCTTTAATGAACGACTCAGGACTCGAGTCCTGAGTCGTTCATTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-778s1c1
Sequence:CCGGCCTGGAAATCACGGACCAATACTCGAGTATTGGTCCGTGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-2402s1c1
Sequence:CCGGCCTCCTGTGTATGAACCCTTTCTCGAGAAAGGGTTCATACACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-1321s1c1
Sequence:CCGGGCAGATGTACTATGCTGAGAACTCGAGTTCTCAGCATAGTACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-3410s1c1
Sequence:CCGGGCTGGGATACACGTTCTCTTTCTCGAGAAAGAGAACGTGTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001488.2-4518s1c1
Sequence:CCGGGCAGTAACAAAGGGTTGCTAACTCGAGTTAGCAACCCTTTGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001488.2-4595s1c1
Sequence:CCGGCCTGTTTCTTTCTACCAACTTCTCGAGAAGTTGGTAGAAAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001488.2-588s1c1
Sequence:CCGGGAGAGCAAATATGCGAGTAATCTCGAGATTACTCGCATATTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001488
ATP8B1 MISSION shRNA Lentiviral Transduction Particles
ATPase, aminophospholipid transporter, class I, type 8B, member 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001488.1-3873s1c1
Sequence:CCGGTCTTTAATGAACGACTCAGGACTCGAGTCCTGAGTCGTTCATTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-778s1c1
Sequence:CCGGCCTGGAAATCACGGACCAATACTCGAGTATTGGTCCGTGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-2402s1c1
Sequence:CCGGCCTCCTGTGTATGAACCCTTTCTCGAGAAAGGGTTCATACACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-1321s1c1
Sequence:CCGGGCAGATGTACTATGCTGAGAACTCGAGTTCTCAGCATAGTACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001488.1-3410s1c1
Sequence:CCGGGCTGGGATACACGTTCTCTTTCTCGAGAAAGAGAACGTGTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001488.2-4518s1c1
Sequence:CCGGGCAGTAACAAAGGGTTGCTAACTCGAGTTAGCAACCCTTTGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001488.2-4595s1c1
Sequence:CCGGCCTGTTTCTTTCTACCAACTTCTCGAGAAGTTGGTAGAAAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001488.2-588s1c1
Sequence:CCGGGAGAGCAAATATGCGAGTAATCTCGAGATTACTCGCATATTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks