EMAIL THIS PAGE TO A FRIEND

ATP8B2

ATPase, aminophospholipid transporter, class I, type 8B, member 2

237 Gene Product Result for
Synonyms: ATPID
UniProtKB ID: P98198, B4E3P4, Q6NT69, Q7Z486, Q96I43, Q96NQ7
Gene ID:
Human(57198) Summary: The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(54667) ATPase, class I, type 8B, member 2
Rat(361984) Atpase, class I, type 8B, member 2
sheep(101103116) ATPase, aminophospholipid transporter, class I, type 8B, member 2
domestic guinea pig(100730215) ATPase, aminophospholipid transporter, class I, type 8B, member 2
naked mole-rat(101723838) ATPase, aminophospholipid transporter, class I, type 8B, member 2
Zebrafish(323754) ATPase, class I, type 8B, member 2
chicken(770035) ATPase, class I, type 8B, member 2
domestic cat(101085949) ATPase, aminophospholipid transporter, class I, type 8B, member 2
cow(785713) ATPase, class I, type 8B, member 2
Horse(100056940) ATPase, aminophospholipid transporter, class I, type 8B, member 2
dog(490447) ATPase, aminophospholipid transporter, class I, type 8B, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020452 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005855 Rosetta Predictions human pricing
NM_020452 Rosetta Predictions human pricing
NM_001024798 Rosetta Predictions rat pricing
XM_001062605 Rosetta Predictions rat pricing
XM_001074928 Rosetta Predictions rat pricing
NM_001081182 Rosetta Predictions mouse pricing
XM_001003218 Rosetta Predictions mouse pricing
XM_001003230 Rosetta Predictions mouse pricing
XM_283873 Rosetta Predictions mouse pricing
XM_894042 Rosetta Predictions mouse pricing
XM_901242 Rosetta Predictions mouse pricing
XM_901246 Rosetta Predictions mouse pricing
XM_901251 Rosetta Predictions mouse pricing
XM_901258 Rosetta Predictions mouse pricing
XM_901263 Rosetta Predictions mouse pricing
XM_901272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190477 predicted 897
2 SASI_Hs01_00190478 predicted 492
3 SASI_Hs01_00190480 predicted 518
4 SASI_Hs01_00190481 predicted 677
5 SASI_Hs01_00190482 predicted 469
6 SASI_Hs01_00190483 predicted 973
7 SASI_Hs01_00190484 predicted 746
8 SASI_Hs01_00190485 predicted 486
9 SASI_Hs01_00190486 predicted 414
10 SASI_Hs02_00305038 predicted 797
11 SASI_Hs01_00190479 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037909 predicted 820
2 SASI_Hs01_00037910 predicted 410
3 SASI_Hs01_00037912 predicted 440
4 SASI_Hs01_00037913 predicted 597
5 SASI_Hs01_00037914 predicted 386
6 SASI_Hs01_00037915 predicted 887
7 SASI_Hs01_00037916 predicted 656
8 SASI_Hs01_00037917 predicted 402
9 SASI_Hs01_00037918 predicted 337
10 SASI_Hs02_00353490 predicted 711
11 SASI_Hs01_00037911 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202712 predicted 354
2 SASI_Rn02_00202713 predicted 717
3 SASI_Rn02_00202714 predicted 792
4 SASI_Rn02_00202715 predicted 2231
5 SASI_Rn02_00202716 predicted 3528
6 SASI_Rn02_00202717 predicted 3436
7 SASI_Rn02_00202718 predicted 1031
8 SASI_Rn02_00202719 predicted 818
9 SASI_Rn02_00202720 predicted 925
10 SASI_Rn02_00202721 predicted 3500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303979 predicted 378
2 SASI_Rn02_00303980 predicted 388
3 SASI_Rn02_00303981 predicted 461
4 SASI_Rn02_00303982 predicted 468
5 SASI_Rn02_00303983 predicted 1141
6 SASI_Rn02_00303984 predicted 388
7 SASI_Rn02_00303985 predicted 1486
8 SASI_Rn02_00303986 predicted 303
9 SASI_Rn02_00303987 predicted 1403
10 SASI_Rn02_00303988 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347782 predicted 343
2 SASI_Rn02_00347783 predicted 705
3 SASI_Rn02_00347784 predicted 776
4 SASI_Rn02_00347785 predicted 2207
5 SASI_Rn02_00347786 predicted 3510
6 SASI_Rn02_00347787 predicted 3419
7 SASI_Rn02_00347788 predicted 1016
8 SASI_Rn02_00347789 predicted 807
9 SASI_Rn02_00347790 predicted 907
10 SASI_Rn02_00347791 predicted 3488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295991 predicted 516
2 SASI_Mm02_00295992 predicted 2067
3 SASI_Mm02_00295993 predicted 902
4 SASI_Mm02_00295994 predicted 701
5 SASI_Mm02_00295995 predicted 3285
6 SASI_Mm02_00295996 predicted 2440
7 SASI_Mm02_00295997 predicted 485
8 SASI_Mm02_00295998 predicted 3490
9 SASI_Mm02_00295999 predicted 2761
10 SASI_Mm02_00296000 predicted 3246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223156 predicted 527
2 SASI_Mm01_00223157 predicted 1827
3 SASI_Mm01_00223158 predicted 3038
4 SASI_Mm01_00223159 predicted 2204
5 SASI_Mm01_00223160 predicted 3252
6 SASI_Mm01_00223161 predicted 483
7 SASI_Mm01_00223162 predicted 3239
8 SASI_Mm01_00223163 predicted 2517
9 SASI_Mm01_00223164 predicted 2157
10 SASI_Mm01_00223165 predicted 3011
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236503 predicted 1704
2 SASI_Mm01_00236504 predicted 542
3 SASI_Mm01_00236505 predicted 2842
4 SASI_Mm01_00236506 predicted 2074
5 SASI_Mm01_00236507 predicted 3054
6 SASI_Mm01_00236508 predicted 1238
7 SASI_Mm01_00236509 predicted 3050
8 SASI_Mm01_00236510 predicted 2318
9 SASI_Mm01_00236511 predicted 2036
10 SASI_Mm01_00236512 predicted 2815
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214078 predicted 522
2 SASI_Mm01_00214079 predicted 2074
3 SASI_Mm01_00214080 predicted 909
4 SASI_Mm01_00214081 predicted 3295
5 SASI_Mm01_00214082 predicted 2451
6 SASI_Mm01_00214083 predicted 3496
7 SASI_Mm01_00214084 predicted 483
8 SASI_Mm01_00214085 predicted 2768
9 SASI_Mm01_00214086 predicted 2399
10 SASI_Mm01_00214087 predicted 3254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213415 predicted 470
2 SASI_Mm01_00213416 predicted 2024
3 SASI_Mm01_00213417 predicted 852
4 SASI_Mm01_00213418 predicted 3166
5 SASI_Mm01_00213419 predicted 2397
6 SASI_Mm01_00213420 predicted 3373
7 SASI_Mm01_00213421 predicted 433
8 SASI_Mm01_00213422 predicted 2640
9 SASI_Mm01_00213423 predicted 2351
10 SASI_Mm01_00213424 predicted 3130
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214462 predicted 1294
2 SASI_Mm01_00214463 predicted 837
3 SASI_Mm01_00214464 predicted 1070
4 SASI_Mm01_00214465 predicted 1279
5 SASI_Mm01_00214466 predicted 1271
6 SASI_Mm01_00214467 predicted 536
7 SASI_Mm01_00214468 predicted 1035
8 SASI_Mm01_00214469 predicted 708
9 SASI_Mm01_00214470 predicted 584
10 SASI_Mm01_00214471 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242857 predicted 2073
2 SASI_Mm01_00242858 predicted 3570
3 SASI_Mm01_00242859 predicted 911
4 SASI_Mm01_00242860 predicted 3216
5 SASI_Mm01_00242861 predicted 2450
6 SASI_Mm01_00242862 predicted 3427
7 SASI_Mm01_00242863 predicted 491
8 SASI_Mm01_00242864 predicted 2693
9 SASI_Mm01_00242865 predicted 2399
10 SASI_Mm01_00242866 predicted 3184
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213171 predicted 1921
2 SASI_Mm01_00213172 predicted 3058
3 SASI_Mm01_00213173 predicted 2285
4 SASI_Mm01_00213174 predicted 3273
5 SASI_Mm01_00213175 predicted 1453
6 SASI_Mm01_00213176 predicted 3255
7 SASI_Mm01_00213177 predicted 2536
8 SASI_Mm01_00213178 predicted 2246
9 SASI_Mm01_00213179 predicted 3020
10 SASI_Mm01_00213180 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204513 predicted 635
2 SASI_Mm01_00204514 predicted 866
3 SASI_Mm01_00204515 predicted 1576
4 SASI_Mm01_00204516 predicted 638
5 SASI_Mm01_00204517 predicted 422
6 SASI_Mm01_00204518 predicted 1077
7 SASI_Mm01_00204519 predicted 857
8 SASI_Mm01_00204520 predicted 846
9 SASI_Mm01_00204521 predicted 608
10 SASI_Mm01_00204522 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268122 predicted 1094
2 SASI_Mm01_00268123 predicted 2231
3 SASI_Mm01_00268124 predicted 1461
4 SASI_Mm01_00268125 predicted 2444
5 SASI_Mm01_00268126 predicted 627
6 SASI_Mm01_00268127 predicted 2434
7 SASI_Mm01_00268128 predicted 1703
8 SASI_Mm01_00268129 predicted 1414
9 SASI_Mm01_00268130 predicted 2193
10 SASI_Mm01_00268131 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219367 predicted 337
2 SASI_Mm01_00219368 predicted 1887
3 SASI_Mm01_00219369 predicted 725
4 SASI_Mm01_00219370 predicted 3028
5 SASI_Mm01_00219371 predicted 2262
6 SASI_Mm01_00219372 predicted 3244
7 SASI_Mm01_00219373 predicted 304
8 SASI_Mm01_00219374 predicted 2505
9 SASI_Mm01_00219375 predicted 2220
10 SASI_Mm01_00219376 predicted 2997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020452
VALIDATED
ATP8B2 MISSION shRNA Bacterial Glycerol Stock
ATPase, aminophospholipid transporter, class I, type 8B, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-709s1c1
Sequence:CCGGCCCAACAACAAACTGGACAAACTCGAGTTTGTCCAGTTTGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-1423s1c1
Sequence:CCGGGCTGACAAGAAGTTCTTATTTCTCGAGAAATAAGAACTTCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-2805s1c1
Sequence:CCGGCCAGTATTTCATCACCCTGTACTCGAGTACAGGGTGATGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-2997s1c1
Sequence:CCGGGCTCATGTTCTTCATTCCCTACTCGAGTAGGGAATGAAGAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-159s1c1
Sequence:CCGGCCGAGAATACAATGAGAAATTCTCGAGAATTTCTCATTGTATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020452
VALIDATED
ATP8B2 MISSION shRNA shRNA Plasmid DNA
ATPase, aminophospholipid transporter, class I, type 8B, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-709s1c1
Sequence:CCGGCCCAACAACAAACTGGACAAACTCGAGTTTGTCCAGTTTGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-1423s1c1
Sequence:CCGGGCTGACAAGAAGTTCTTATTTCTCGAGAAATAAGAACTTCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-2805s1c1
Sequence:CCGGCCAGTATTTCATCACCCTGTACTCGAGTACAGGGTGATGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-2997s1c1
Sequence:CCGGGCTCATGTTCTTCATTCCCTACTCGAGTAGGGAATGAAGAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-159s1c1
Sequence:CCGGCCGAGAATACAATGAGAAATTCTCGAGAATTTCTCATTGTATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020452
VALIDATED
ATP8B2 MISSION shRNA Lentiviral Transduction Particles
ATPase, aminophospholipid transporter, class I, type 8B, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-709s1c1
Sequence:CCGGCCCAACAACAAACTGGACAAACTCGAGTTTGTCCAGTTTGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-1423s1c1
Sequence:CCGGGCTGACAAGAAGTTCTTATTTCTCGAGAAATAAGAACTTCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-2805s1c1
Sequence:CCGGCCAGTATTTCATCACCCTGTACTCGAGTACAGGGTGATGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-2997s1c1
Sequence:CCGGGCTCATGTTCTTCATTCCCTACTCGAGTAGGGAATGAAGAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020452.1-159s1c1
Sequence:CCGGCCGAGAATACAATGAGAAATTCTCGAGAATTTCTCATTGTATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081182
VALIDATED
ATP8B2 MISSION shRNA Bacterial Glycerol Stock
ATPase, aminophospholipid transporter, class I, type 8B, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081182.1-3144s21c1
Sequence:CCGGTCTCAGCCCAGACCGTTTATGCTCGAGCATAAACGGTCTGGGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081182.1-1253s21c1
Sequence:CCGGGTGATCCTGGCCATCGGTAATCTCGAGATTACCGATGGCCAGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081182.1-4851s21c1
Sequence:CCGGGTAGTCCTGAGACGGGAAATACTCGAGTATTTCCCGTCTCAGGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081182.1-2976s21c1
Sequence:CCGGCTGTCCTGGCTTCCGATTATTCTCGAGAATAATCGGAAGCCAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081182.1-967s21c1
Sequence:CCGGCAGGTTTGATGGCGAAGTAATCTCGAGATTACTTCGCCATCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081182
VALIDATED
ATP8B2 MISSION shRNA shRNA Plasmid DNA
ATPase, aminophospholipid transporter, class I, type 8B, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081182.1-3144s21c1
Sequence:CCGGTCTCAGCCCAGACCGTTTATGCTCGAGCATAAACGGTCTGGGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081182.1-1253s21c1
Sequence:CCGGGTGATCCTGGCCATCGGTAATCTCGAGATTACCGATGGCCAGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081182.1-4851s21c1
Sequence:CCGGGTAGTCCTGAGACGGGAAATACTCGAGTATTTCCCGTCTCAGGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081182.1-2976s21c1
Sequence:CCGGCTGTCCTGGCTTCCGATTATTCTCGAGAATAATCGGAAGCCAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081182.1-967s21c1
Sequence:CCGGCAGGTTTGATGGCGAAGTAATCTCGAGATTACTTCGCCATCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081182
VALIDATED
ATP8B2 MISSION shRNA Lentiviral Transduction Particles
ATPase, aminophospholipid transporter, class I, type 8B, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081182.1-3144s21c1
Sequence:CCGGTCTCAGCCCAGACCGTTTATGCTCGAGCATAAACGGTCTGGGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081182.1-1253s21c1
Sequence:CCGGGTGATCCTGGCCATCGGTAATCTCGAGATTACCGATGGCCAGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081182.1-4851s21c1
Sequence:CCGGGTAGTCCTGAGACGGGAAATACTCGAGTATTTCCCGTCTCAGGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081182.1-2976s21c1
Sequence:CCGGCTGTCCTGGCTTCCGATTATTCTCGAGAATAATCGGAAGCCAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081182.1-967s21c1
Sequence:CCGGCAGGTTTGATGGCGAAGTAATCTCGAGATTACTTCGCCATCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks