EMAIL THIS PAGE TO A FRIEND

ATP8B3

ATPase, aminophospholipid transporter, class I, type 8B, member 3

58 Gene Product Result for
Synonyms: ATPIK
UniProtKB ID: O60423, Q7Z485, Q8IVB8, Q8N4Y8, Q96M22
Gene ID:
Human(148229) Summary: The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(67331) ATPase, class I, type 8B, member 3
Rat(299616) ATPase, aminophospholipid transporter, class I, type 8B, member 3
chicken(428328) ATPase, aminophospholipid transporter, class I, type 8B, member 3
cow(618059) ATPase, aminophospholipid transporter, class I, type 8B, member 3
Horse(100146926) ATPase, aminophospholipid transporter, class I, type 8B, member 3
domestic cat(101099184) ATPase, aminophospholipid transporter, class I, type 8B, member 3
dog(612245) ATPase, aminophospholipid transporter, class I, type 8B, member 3
naked mole-rat(101723336) ATPase, aminophospholipid transporter, class I, type 8B, member 3
sheep(101116987) ATPase, aminophospholipid transporter, class I, type 8B, member 3
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155591 MISSION® esiRNA esiRNA human ATP8B3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138813 Rosetta Predictions human pricing
XM_001076355 Rosetta Predictions rat pricing
XM_234937 Rosetta Predictions rat pricing
NM_026094 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152179 predicted 1156
2 SASI_Hs01_00152181 predicted 2475
3 SASI_Hs01_00152182 predicted 1773
4 SASI_Hs01_00152183 predicted 2570
5 SASI_Hs01_00152184 predicted 2129
6 SASI_Hs01_00152185 predicted 2478
7 SASI_Hs01_00152186 predicted 3207
8 SASI_Hs01_00152187 predicted 2043
9 SASI_Hs01_00152188 predicted 4014
10 SASI_Hs02_00363976 predicted 3053
11 SASI_Hs01_00152180 predicted 3779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352981 predicted 3328
2 SASI_Rn02_00352982 predicted 3952
3 SASI_Rn02_00352983 predicted 4041
4 SASI_Rn02_00352984 predicted 1090
5 SASI_Rn02_00352985 predicted 995
6 SASI_Rn02_00352986 predicted 2281
7 SASI_Rn02_00352987 predicted 1934
8 SASI_Rn02_00352988 predicted 2570
9 SASI_Rn02_00352989 predicted 2819
10 SASI_Rn02_00352990 predicted 3412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388798 predicted 1181
2 SASI_Rn02_00388799 predicted 1090
3 SASI_Rn02_00388800 predicted 988
4 SASI_Rn02_00388801 predicted 886
5 SASI_Rn02_00388802 predicted 1931
6 SASI_Rn02_00388803 predicted 1445
7 SASI_Rn02_00388804 predicted 1128
8 SASI_Rn02_00388805 predicted 1447
9 SASI_Rn02_00388806 predicted 801
10 SASI_Rn02_00388807 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193120 predicted 2315
2 SASI_Mm01_00193121 predicted 1380
3 SASI_Mm01_00193122 predicted 2848
4 SASI_Mm01_00193123 predicted 298
5 SASI_Mm01_00193125 predicted 3358
6 SASI_Mm02_00329667 predicted 3974
7 SASI_Mm01_00193126 predicted 3451
8 SASI_Mm01_00193127 predicted 3043
9 SASI_Mm01_00193128 predicted 1397
10 SASI_Mm01_00193129 predicted 2265
11 SASI_Mm01_00193124 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138813
ATP8B3 MISSION shRNA Bacterial Glycerol Stock
ATPase, aminophospholipid transporter, class I, type 8B, member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138813.2-4022s21c1
Sequence:CCGGTCATCACTCAGGGCACAATTCCTCGAGGAATTGTGCCCTGAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138813.2-1098s21c1
Sequence:CCGGCAAAGAACTGGCCACTATAAACTCGAGTTTATAGTGGCCAGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138813.2-4459s21c1
Sequence:CCGGGAAAGCCAGCTGTCGTCATTTCTCGAGAAATGACGACAGCTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138813.2-1320s21c1
Sequence:CCGGGAACTGTGGCAAGATCCATTTCTCGAGAAATGGATCTTGCCACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-4064s1c1
Sequence:CCGGGCAGTGACATAGCATCTGAATCTCGAGATTCAGATGCTATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-3222s1c1
Sequence:CCGGCCTGCGCTACTTCTTCTACAACTCGAGTTGTAGAAGAAGTAGCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-3450s1c1
Sequence:CCGGGCTCTTCAACTACTGGGTCTTCTCGAGAAGACCCAGTAGTTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-3684s1c1
Sequence:CCGGCCTTGGTTTCTACGCCATCATCTCGAGATGATGGCGTAGAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-1271s1c1
Sequence:CCGGCCTGCTATGGACTGGTCATTTCTCGAGAAATGACCAGTCCATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138813
ATP8B3 MISSION shRNA shRNA Plasmid DNA
ATPase, aminophospholipid transporter, class I, type 8B, member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138813.2-4022s21c1
Sequence:CCGGTCATCACTCAGGGCACAATTCCTCGAGGAATTGTGCCCTGAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138813.2-1098s21c1
Sequence:CCGGCAAAGAACTGGCCACTATAAACTCGAGTTTATAGTGGCCAGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138813.2-4459s21c1
Sequence:CCGGGAAAGCCAGCTGTCGTCATTTCTCGAGAAATGACGACAGCTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138813.2-1320s21c1
Sequence:CCGGGAACTGTGGCAAGATCCATTTCTCGAGAAATGGATCTTGCCACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-4064s1c1
Sequence:CCGGGCAGTGACATAGCATCTGAATCTCGAGATTCAGATGCTATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-3222s1c1
Sequence:CCGGCCTGCGCTACTTCTTCTACAACTCGAGTTGTAGAAGAAGTAGCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-3450s1c1
Sequence:CCGGGCTCTTCAACTACTGGGTCTTCTCGAGAAGACCCAGTAGTTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-3684s1c1
Sequence:CCGGCCTTGGTTTCTACGCCATCATCTCGAGATGATGGCGTAGAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-1271s1c1
Sequence:CCGGCCTGCTATGGACTGGTCATTTCTCGAGAAATGACCAGTCCATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138813
ATP8B3 MISSION shRNA Lentiviral Transduction Particles
ATPase, aminophospholipid transporter, class I, type 8B, member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138813.2-4022s21c1
Sequence:CCGGTCATCACTCAGGGCACAATTCCTCGAGGAATTGTGCCCTGAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138813.2-1098s21c1
Sequence:CCGGCAAAGAACTGGCCACTATAAACTCGAGTTTATAGTGGCCAGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138813.2-4459s21c1
Sequence:CCGGGAAAGCCAGCTGTCGTCATTTCTCGAGAAATGACGACAGCTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138813.2-1320s21c1
Sequence:CCGGGAACTGTGGCAAGATCCATTTCTCGAGAAATGGATCTTGCCACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-4064s1c1
Sequence:CCGGGCAGTGACATAGCATCTGAATCTCGAGATTCAGATGCTATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-3222s1c1
Sequence:CCGGCCTGCGCTACTTCTTCTACAACTCGAGTTGTAGAAGAAGTAGCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-3450s1c1
Sequence:CCGGGCTCTTCAACTACTGGGTCTTCTCGAGAAGACCCAGTAGTTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-3684s1c1
Sequence:CCGGCCTTGGTTTCTACGCCATCATCTCGAGATGATGGCGTAGAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138813.1-1271s1c1
Sequence:CCGGCCTGCTATGGACTGGTCATTTCTCGAGAAATGACCAGTCCATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026094
ATP8B3 MISSION shRNA Bacterial Glycerol Stock
ATPase, aminophospholipid transporter, class I, type 8B, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026094.3-4140s1c1
Sequence:CCGGCGCTGGGAGATTCCCAGTCATCTCGAGATGACTGGGAATCTCCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-2901s1c1
Sequence:CCGGGCCCAGATATGGTTCTCTCTACTCGAGTAGAGAGAACCATATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-326s1c1
Sequence:CCGGCCATCGAATGTCCAATCTCTACTCGAGTAGAGATTGGACATTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-2861s1c1
Sequence:CCGGCCTGCGTTACTTCTTCTACAACTCGAGTTGTAGAAGAAGTAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-2326s1c1
Sequence:CCGGCCTTGGTTATCAATGGAGAATCTCGAGATTCTCCATTGATAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026094
ATP8B3 MISSION shRNA shRNA Plasmid DNA
ATPase, aminophospholipid transporter, class I, type 8B, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026094.3-4140s1c1
Sequence:CCGGCGCTGGGAGATTCCCAGTCATCTCGAGATGACTGGGAATCTCCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-2901s1c1
Sequence:CCGGGCCCAGATATGGTTCTCTCTACTCGAGTAGAGAGAACCATATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-326s1c1
Sequence:CCGGCCATCGAATGTCCAATCTCTACTCGAGTAGAGATTGGACATTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-2861s1c1
Sequence:CCGGCCTGCGTTACTTCTTCTACAACTCGAGTTGTAGAAGAAGTAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-2326s1c1
Sequence:CCGGCCTTGGTTATCAATGGAGAATCTCGAGATTCTCCATTGATAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026094
ATP8B3 MISSION shRNA Lentiviral Transduction Particles
ATPase, aminophospholipid transporter, class I, type 8B, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026094.3-4140s1c1
Sequence:CCGGCGCTGGGAGATTCCCAGTCATCTCGAGATGACTGGGAATCTCCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-2901s1c1
Sequence:CCGGGCCCAGATATGGTTCTCTCTACTCGAGTAGAGAGAACCATATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-326s1c1
Sequence:CCGGCCATCGAATGTCCAATCTCTACTCGAGTAGAGATTGGACATTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-2861s1c1
Sequence:CCGGCCTGCGTTACTTCTTCTACAACTCGAGTTGTAGAAGAAGTAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026094.3-2326s1c1
Sequence:CCGGCCTTGGTTATCAATGGAGAATCTCGAGATTCTCCATTGATAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks