EMAIL THIS PAGE TO A FRIEND

ATP8B4

ATPase, class I, type 8B, member 4

191 Gene Product Result for
Synonyms: ATPIM
UniProtKB ID: Q8TF62, Q9H727
Gene ID:
Human(79895) Summary: This gene encodes a member of the cation transport ATPase (P-type) family and type IV subfamily. The encoded protein is involved in phospholipid transport in the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(241633) ATPase, class I, type 8B, member 4
Rat(311396) ATPase, class I, type 8B, member 4
sheep(101108837) ATPase, class I, type 8B, member 4
Domestic Rabbit(100349269) ATPase, class I, type 8B, member 4
domestic guinea pig(100715423) ATPase, class I, type 8B, member 4
naked mole-rat(101712888) ATPase, class I, type 8B, member 4
dog(487549) ATPase, class I, type 8B, member 4
Horse(100069998) ATPase, class I, type 8B, member 4
domestic cat(101084112) ATPase, class I, type 8B, member 4
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024837 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024837 Rosetta Predictions human pricing
XM_001055184 Rosetta Predictions rat pricing
XM_001077984 Rosetta Predictions rat pricing
XM_001078004 Rosetta Predictions rat pricing
NM_001080944 Rosetta Predictions mouse pricing
XM_001005370 Rosetta Predictions mouse pricing
XM_894365 Rosetta Predictions mouse pricing
XM_901491 Rosetta Predictions mouse pricing
XM_901499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060544 predicted 751
2 SASI_Hs01_00060545 predicted 2662
3 SASI_Hs01_00060546 predicted 901
4 SASI_Hs01_00060547 predicted 3125
5 SASI_Hs01_00060548 predicted 3157
6 SASI_Hs02_00357404 predicted 2121
7 SASI_Hs01_00060550 predicted 2490
8 SASI_Hs01_00060551 predicted 1370
9 SASI_Hs02_00357405 predicted 2402
10 SASI_Hs01_00060553 predicted 2201
11 SASI_Hs01_00060549 predicted 3511
12 SASI_Hs01_00060552 predicted 2467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278732 predicted 3583
2 SASI_Rn02_00278733 predicted 3560
3 SASI_Rn02_00278734 predicted 3256
4 SASI_Rn02_00278735 predicted 3550
5 SASI_Rn02_00278736 predicted 3284
6 SASI_Rn02_00278737 predicted 3275
7 SASI_Rn02_00278738 predicted 3512
8 SASI_Rn02_00278739 predicted 3520
9 SASI_Rn02_00278740 predicted 3595
10 SASI_Rn02_00278741 predicted 3399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359222 predicted 364
2 SASI_Rn02_00359223 predicted 2268
3 SASI_Rn02_00359224 predicted 1229
4 SASI_Rn02_00359225 predicted 3274
5 SASI_Rn02_00359226 predicted 3327
6 SASI_Rn02_00359227 predicted 3164
7 SASI_Rn02_00359228 predicted 582
8 SASI_Rn02_00359229 predicted 3850
9 SASI_Rn02_00359230 predicted 3786
10 SASI_Rn02_00359231 predicted 1766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359316 predicted 204
2 SASI_Rn02_00359317 predicted 2119
3 SASI_Rn02_00359318 predicted 1073
4 SASI_Rn02_00359319 predicted 3115
5 SASI_Rn02_00359320 predicted 3176
6 SASI_Rn02_00359321 predicted 425
7 SASI_Rn02_00359322 predicted 3693
8 SASI_Rn02_00359323 predicted 3630
9 SASI_Rn02_00359324 predicted 1608
10 SASI_Rn02_00359325 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294095 predicted 2363
2 SASI_Mm02_00294096 predicted 2877
3 SASI_Mm02_00294097 predicted 1461
4 SASI_Mm02_00294098 predicted 2589
5 SASI_Mm02_00294099 predicted 1046
6 SASI_Mm02_00294100 predicted 1995
7 SASI_Mm02_00294101 predicted 413
8 SASI_Mm02_00294102 predicted 682
9 SASI_Mm02_00294103 predicted 1891
10 SASI_Mm02_00294104 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279518 predicted 2542
2 SASI_Mm01_00279519 predicted 3062
3 SASI_Mm01_00279520 predicted 1637
4 SASI_Mm01_00279521 predicted 2772
5 SASI_Mm01_00279522 predicted 1227
6 SASI_Mm01_00279523 predicted 2166
7 SASI_Mm01_00279524 predicted 595
8 SASI_Mm01_00279525 predicted 864
9 SASI_Mm01_00279526 predicted 1768
10 SASI_Mm01_00279527 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246455 predicted 2530
2 SASI_Mm01_00246456 predicted 3051
3 SASI_Mm01_00246457 predicted 1626
4 SASI_Mm01_00246458 predicted 2758
5 SASI_Mm01_00246459 predicted 1215
6 SASI_Mm01_00246460 predicted 2165
7 SASI_Mm01_00246461 predicted 584
8 SASI_Mm01_00246462 predicted 851
9 SASI_Mm01_00246463 predicted 1754
10 SASI_Mm01_00246464 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258360 predicted 1484
2 SASI_Mm01_00258361 predicted 900
3 SASI_Mm01_00258362 predicted 1078
4 SASI_Mm01_00258363 predicted 2017
5 SASI_Mm01_00258364 predicted 437
6 SASI_Mm01_00258365 predicted 711
7 SASI_Mm01_00258366 predicted 1919
8 SASI_Mm01_00258367 predicted 1615
9 SASI_Mm01_00258368 predicted 211
10 SASI_Mm01_00258369 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219508 predicted 2392
2 SASI_Mm01_00219509 predicted 2900
3 SASI_Mm01_00219510 predicted 1484
4 SASI_Mm01_00219511 predicted 2616
5 SASI_Mm01_00219512 predicted 1073
6 SASI_Mm01_00219513 predicted 2018
7 SASI_Mm01_00219514 predicted 436
8 SASI_Mm01_00219515 predicted 708
9 SASI_Mm01_00219516 predicted 1616
10 SASI_Mm01_00219517 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024837
ATP8B4 MISSION shRNA Bacterial Glycerol Stock
ATPase, class I, type 8B, member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024837.2-4452s1c1
Sequence:CCGGCGCCACTAAGTATTCTAAATACTCGAGTATTTAGAATACTTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-2246s1c1
Sequence:CCGGGCAGGGAATAATGCTGTGGAACTCGAGTTCCACAGCATTATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-3292s1c1
Sequence:CCGGCCAGTTTCCATTTGTTGGTAACTCGAGTTACCAACAAATGGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-669s1c1
Sequence:CCGGGCCATGCACTATCAGTTACTTCTCGAGAAGTAACTGATAGTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-1826s1c1
Sequence:CCGGGCAGATACTATTCTGTTTGAACTCGAGTTCAAACAGAATAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024837.2-4061s21c1
Sequence:CCGGATGGATCCTCAGGCGGATAAACTCGAGTTTATCCGCCTGAGGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024837.2-2127s21c1
Sequence:CCGGGTTTATCACTAGCCAATATTACTCGAGTAATATTGGCTAGTGATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024837
ATP8B4 MISSION shRNA shRNA Plasmid DNA
ATPase, class I, type 8B, member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024837.2-4452s1c1
Sequence:CCGGCGCCACTAAGTATTCTAAATACTCGAGTATTTAGAATACTTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-2246s1c1
Sequence:CCGGGCAGGGAATAATGCTGTGGAACTCGAGTTCCACAGCATTATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-3292s1c1
Sequence:CCGGCCAGTTTCCATTTGTTGGTAACTCGAGTTACCAACAAATGGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-669s1c1
Sequence:CCGGGCCATGCACTATCAGTTACTTCTCGAGAAGTAACTGATAGTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-1826s1c1
Sequence:CCGGGCAGATACTATTCTGTTTGAACTCGAGTTCAAACAGAATAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024837.2-4061s21c1
Sequence:CCGGATGGATCCTCAGGCGGATAAACTCGAGTTTATCCGCCTGAGGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024837.2-2127s21c1
Sequence:CCGGGTTTATCACTAGCCAATATTACTCGAGTAATATTGGCTAGTGATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024837
ATP8B4 MISSION shRNA Lentiviral Transduction Particles
ATPase, class I, type 8B, member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024837.2-4452s1c1
Sequence:CCGGCGCCACTAAGTATTCTAAATACTCGAGTATTTAGAATACTTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-2246s1c1
Sequence:CCGGGCAGGGAATAATGCTGTGGAACTCGAGTTCCACAGCATTATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-3292s1c1
Sequence:CCGGCCAGTTTCCATTTGTTGGTAACTCGAGTTACCAACAAATGGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-669s1c1
Sequence:CCGGGCCATGCACTATCAGTTACTTCTCGAGAAGTAACTGATAGTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024837.2-1826s1c1
Sequence:CCGGGCAGATACTATTCTGTTTGAACTCGAGTTCAAACAGAATAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024837.2-4061s21c1
Sequence:CCGGATGGATCCTCAGGCGGATAAACTCGAGTTTATCCGCCTGAGGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024837.2-2127s21c1
Sequence:CCGGGTTTATCACTAGCCAATATTACTCGAGTAATATTGGCTAGTGATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080944
ATP8B4 MISSION shRNA Bacterial Glycerol Stock
ATPase, class I, type 8B, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-1256s21c1
Sequence:CCGGACTGGGCCAGATCGAATATATCTCGAGATATATTCGATCTGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-2370s21c1
Sequence:CCGGGAATATGCCTTAGTCATAAATCTCGAGATTTATGACTAAGGCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-1759s21c1
Sequence:CCGGGAAACCCAGAAGGACGTATAACTCGAGTTATACGTCCTTCTGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-2191s21c1
Sequence:CCGGACGCCATGGATGCTCTATTTGCTCGAGCAAATAGAGCATCCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080944.3-4290s21c1
Sequence:CCGGTGCTAACATGGTTAGGTTTATCTCGAGATAAACCTAACCATGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080944
ATP8B4 MISSION shRNA shRNA Plasmid DNA
ATPase, class I, type 8B, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-1256s21c1
Sequence:CCGGACTGGGCCAGATCGAATATATCTCGAGATATATTCGATCTGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-2370s21c1
Sequence:CCGGGAATATGCCTTAGTCATAAATCTCGAGATTTATGACTAAGGCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-1759s21c1
Sequence:CCGGGAAACCCAGAAGGACGTATAACTCGAGTTATACGTCCTTCTGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-2191s21c1
Sequence:CCGGACGCCATGGATGCTCTATTTGCTCGAGCAAATAGAGCATCCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080944.3-4290s21c1
Sequence:CCGGTGCTAACATGGTTAGGTTTATCTCGAGATAAACCTAACCATGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080944
ATP8B4 MISSION shRNA Lentiviral Transduction Particles
ATPase, class I, type 8B, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-1256s21c1
Sequence:CCGGACTGGGCCAGATCGAATATATCTCGAGATATATTCGATCTGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-2370s21c1
Sequence:CCGGGAATATGCCTTAGTCATAAATCTCGAGATTTATGACTAAGGCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-1759s21c1
Sequence:CCGGGAAACCCAGAAGGACGTATAACTCGAGTTATACGTCCTTCTGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080944.3-2191s21c1
Sequence:CCGGACGCCATGGATGCTCTATTTGCTCGAGCAAATAGAGCATCCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080944.3-4290s21c1
Sequence:CCGGTGCTAACATGGTTAGGTTTATCTCGAGATAAACCTAACCATGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks