EMAIL THIS PAGE TO A FRIEND

ATP9A

ATPase, class II, type 9A

40 Gene Product Result for
Synonyms: ATPIIA
Gene ID:
Mouse(11981) ATPase, class II, type 9A
Rat(84011) ATPase, class II, type 9A
chicken(419345) ATPase, class II, type 9A
cow(516579) ATPase, class II, type 9A
Horse(100052707) ATPase, class II, type 9A
domestic cat(101080270) ATPase, class II, type 9A
dog(477265) ATPase, class II, type 9A
domestic guinea pig(100722598) ATPase, class II, type 9A
naked mole-rat(101721413) ATPase, class II, type 9A
sheep(101119494) ATPase, class II, type 9A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_030577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_030577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_030577 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006045 Rosetta Predictions human pricing
NM_015731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097024 predicted 2426
2 SASI_Hs01_00097025 predicted 263
3 SASI_Hs01_00097026 predicted 1074
4 SASI_Hs01_00097027 predicted 647
5 SASI_Hs01_00097028 predicted 652
6 SASI_Hs01_00097029 predicted 796
7 SASI_Hs01_00097030 predicted 285
8 SASI_Hs02_00340798 predicted 2197
9 SASI_Hs01_00097031 predicted 1878
10 SASI_Hs01_00097032 predicted 1176
11 SASI_Hs01_00097033 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103629 predicted 3093
2 SASI_Mm01_00103630 predicted 423
3 SASI_Mm01_00103631 predicted 2244
4 SASI_Mm01_00103632 predicted 1073
5 SASI_Mm01_00103634 predicted 255
6 SASI_Mm01_00103635 predicted 390
7 SASI_Mm01_00103636 predicted 2809
8 SASI_Mm01_00103637 predicted 2803
9 SASI_Mm01_00103638 predicted 710
10 SASI_Mm02_00323055 predicted 2766
11 SASI_Mm01_00103633 predicted 1207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015731
VALIDATED
ATP9A MISSION shRNA Bacterial Glycerol Stock
ATPase, class II, type 9A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-3378s1c1
Sequence:CCGGTGAGAGCTGTACCTATCAGAACTCGAGTTCTGATAGGTACAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-2250s1c1
Sequence:CCGGCCTGGAGGTTTGCCTCAAATACTCGAGTATTTGAGGCAAACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015731.2-1314s1c1
Sequence:CCGGGCAGAGTCACATCTTCAGCATCTCGAGATGCTGAAGATGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-2806s1c1
Sequence:CCGGCTGTCCTACAAGACGTTCTTACTCGAGTAAGAACGTCTTGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-426s1c1
Sequence:CCGGCCGATGTTATGTGCGTGACAACTCGAGTTGTCACGCACATAACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-1314s21c1
Sequence:CCGGGCAGAGTCACATCTTCAGCATCTCGAGATGCTGAAGATGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-2806s21c1
Sequence:CCGGCTGTCCTACAAGACGTTCTTACTCGAGTAAGAACGTCTTGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015731.3-3379s21c1
Sequence:CCGGTGAGAGCTGTACCTATCAGAACTCGAGTTCTGATAGGTACAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-426s21c1
Sequence:CCGGCCGATGTTATGTGCGTGACAACTCGAGTTGTCACGCACATAACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-2250s21c1
Sequence:CCGGCCTGGAGGTTTGCCTCAAATACTCGAGTATTTGAGGCAAACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015731
VALIDATED
ATP9A MISSION shRNA shRNA Plasmid DNA
ATPase, class II, type 9A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-3378s1c1
Sequence:CCGGTGAGAGCTGTACCTATCAGAACTCGAGTTCTGATAGGTACAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-2250s1c1
Sequence:CCGGCCTGGAGGTTTGCCTCAAATACTCGAGTATTTGAGGCAAACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015731.2-1314s1c1
Sequence:CCGGGCAGAGTCACATCTTCAGCATCTCGAGATGCTGAAGATGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-2806s1c1
Sequence:CCGGCTGTCCTACAAGACGTTCTTACTCGAGTAAGAACGTCTTGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-426s1c1
Sequence:CCGGCCGATGTTATGTGCGTGACAACTCGAGTTGTCACGCACATAACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-1314s21c1
Sequence:CCGGGCAGAGTCACATCTTCAGCATCTCGAGATGCTGAAGATGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-2806s21c1
Sequence:CCGGCTGTCCTACAAGACGTTCTTACTCGAGTAAGAACGTCTTGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015731.3-3379s21c1
Sequence:CCGGTGAGAGCTGTACCTATCAGAACTCGAGTTCTGATAGGTACAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-426s21c1
Sequence:CCGGCCGATGTTATGTGCGTGACAACTCGAGTTGTCACGCACATAACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-2250s21c1
Sequence:CCGGCCTGGAGGTTTGCCTCAAATACTCGAGTATTTGAGGCAAACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015731
VALIDATED
ATP9A MISSION shRNA Lentiviral Transduction Particles
ATPase, class II, type 9A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-3378s1c1
Sequence:CCGGTGAGAGCTGTACCTATCAGAACTCGAGTTCTGATAGGTACAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-2250s1c1
Sequence:CCGGCCTGGAGGTTTGCCTCAAATACTCGAGTATTTGAGGCAAACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015731.2-1314s1c1
Sequence:CCGGGCAGAGTCACATCTTCAGCATCTCGAGATGCTGAAGATGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-2806s1c1
Sequence:CCGGCTGTCCTACAAGACGTTCTTACTCGAGTAAGAACGTCTTGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015731.2-426s1c1
Sequence:CCGGCCGATGTTATGTGCGTGACAACTCGAGTTGTCACGCACATAACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-1314s21c1
Sequence:CCGGGCAGAGTCACATCTTCAGCATCTCGAGATGCTGAAGATGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-2806s21c1
Sequence:CCGGCTGTCCTACAAGACGTTCTTACTCGAGTAAGAACGTCTTGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015731.3-3379s21c1
Sequence:CCGGTGAGAGCTGTACCTATCAGAACTCGAGTTCTGATAGGTACAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-426s21c1
Sequence:CCGGCCGATGTTATGTGCGTGACAACTCGAGTTGTCACGCACATAACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015731.3-2250s21c1
Sequence:CCGGCCTGGAGGTTTGCCTCAAATACTCGAGTATTTGAGGCAAACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_030577
VALIDATED
ATP9A MISSION shRNA Bacterial Glycerol Stock
ATPase, class II, type 9A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000050733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030577.8-1308s1c1
Sequence:CCGGGCTGGCATTGTGCAGTACAATCTCGAGATTGTACTGCACAATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_030577.8-2567s1c1
Sequence:CCGGCCTGGTGTTCTTACACGAGTTCTCGAGAACTCGTGTAAGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030577.8-243s1c1
Sequence:CCGGCGATCGTATGTGTACGCAGAACTCGAGTTCTGCGTACACATACGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030577.8-1212s1c1
Sequence:CCGGCCTTTCACCTATGAAAGCAAACTCGAGTTTGCTTTCATAGGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_030577
VALIDATED
ATP9A MISSION shRNA shRNA Plasmid DNA
ATPase, class II, type 9A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000050733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030577.8-1308s1c1
Sequence:CCGGGCTGGCATTGTGCAGTACAATCTCGAGATTGTACTGCACAATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_030577.8-2567s1c1
Sequence:CCGGCCTGGTGTTCTTACACGAGTTCTCGAGAACTCGTGTAAGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030577.8-243s1c1
Sequence:CCGGCGATCGTATGTGTACGCAGAACTCGAGTTCTGCGTACACATACGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030577.8-1212s1c1
Sequence:CCGGCCTTTCACCTATGAAAGCAAACTCGAGTTTGCTTTCATAGGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_030577
VALIDATED
ATP9A MISSION shRNA Lentiviral Transduction Particles
ATPase, class II, type 9A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000050733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030577.8-1308s1c1
Sequence:CCGGGCTGGCATTGTGCAGTACAATCTCGAGATTGTACTGCACAATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_030577.8-2567s1c1
Sequence:CCGGCCTGGTGTTCTTACACGAGTTCTCGAGAACTCGTGTAAGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030577.8-243s1c1
Sequence:CCGGCGATCGTATGTGTACGCAGAACTCGAGTTCTGCGTACACATACGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030577.8-1212s1c1
Sequence:CCGGCCTTTCACCTATGAAAGCAAACTCGAGTTTGCTTTCATAGGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks