EMAIL THIS PAGE TO A FRIEND

ATP9B

ATPase, class II, type 9B

99 Gene Product Result for
Synonyms: ATPASEP ATPIIB NEO1L hMMR1
UniProtKB ID: O43861, O60872, Q08AD8, Q08AD9
Gene ID:
Mouse(50771) ATPase, class II, type 9B
Rat(291411) ATPase, class II, type 9B
sheep(101108356) ATPase, class II, type 9B
naked mole-rat(101699526) ATPase, class II, type 9B
domestic guinea pig(100730522) ATPase, class II, type 9B
Zebrafish(568160) ATPase, class II, type 9B
chicken(420817) ATPase, class II, type 9B
dog(483926) ATPase, class II, type 9B
cow(510301) ATPase, class II, type 9B
domestic cat(101101004) ATPase, class II, type 9B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087421 MISSION® esiRNA esiRNA human ATP9B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198531 Rosetta Predictions human pricing
NM_001106130 Rosetta Predictions rat pricing
NM_015805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070463 predicted 582
2 SASI_Hs01_00070464 predicted 2488
3 SASI_Hs02_00372119 predicted 510
4 SASI_Hs01_00070465 predicted 1996
5 SASI_Hs01_00070466 predicted 653
6 SASI_Hs01_00070467 predicted 2741
7 SASI_Hs01_00070468 predicted 1038
8 SASI_Hs01_00070470 predicted 2110
9 SASI_Hs01_00070471 predicted 939
10 SASI_Hs01_00070472 predicted 1275
11 SASI_Hs01_00070469 predicted 3284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215918 predicted 1225
2 SASI_Rn02_00215919 predicted 637
3 SASI_Rn02_00215920 predicted 1633
4 SASI_Rn02_00215921 predicted 1339
5 SASI_Rn02_00215922 predicted 2236
6 SASI_Rn02_00215923 predicted 1377
7 SASI_Rn02_00215924 predicted 2484
8 SASI_Rn02_00215925 predicted 1041
9 SASI_Rn02_00215926 predicted 467
10 SASI_Rn02_00215927 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200350 predicted 1262
2 SASI_Mm01_00200351 predicted 685
3 SASI_Mm01_00200352 predicted 2265
4 SASI_Mm01_00200353 predicted 3002
5 SASI_Mm02_00323188 predicted 3045
6 SASI_Mm01_00200354 predicted 2229
7 SASI_Mm01_00200355 predicted 496
8 SASI_Mm02_00323189 predicted 1410
9 SASI_Mm01_00200356 predicted 1141
10 SASI_Mm01_00200357 predicted 2594
11 SASI_Mm01_00200358 predicted 2535
12 SASI_Mm01_00200359 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198531
VALIDATED
ATP9B MISSION shRNA Bacterial Glycerol Stock
ATPase, class II, type 9B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-1148s21c1
Sequence:CCGCTCGGCTGACGAAAGCGCTATTCTCGAGAATAGCGCTTTCGTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-144s21c1
Sequence:CCGGGAGGATGAGTCTGCGCATTTGCTCGAGCAAATGCGCAGACTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-1300s21c1
Sequence:CCGGACATGGGCAAAGCGGTGTATGCTCGAGCATACACCGCTTTGCCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-1050s21c1
Sequence:CCGGGTAATAGGTGTTGTCATTTATCTCGAGATAAATGACAACACCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198531.3-3312s1c1
Sequence:CCGGGCTTTCTTAGATGTTGCCTTTCTCGAGAAAGGCAACATCTAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198531.3-585s1c1
Sequence:CCGGGCTGTTACTATGACACGGGAACTCGAGTTCCCGTGTCATAGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_198531.3-1027s1c1
Sequence:CCGGGCACCATTGTTGCATCAGGTACTCGAGTACCTGATGCAACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_198531.3-174s1c1
Sequence:CCGGCCACTAATGATGTCTGAAGAACTCGAGTTCTTCAGACATCATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_198531.3-1632s1c1
Sequence:CCGGCGAATCCATGAAGCCGTGAAACTCGAGTTTCACGGCTTCATGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198531
VALIDATED
ATP9B MISSION shRNA shRNA Plasmid DNA
ATPase, class II, type 9B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-1148s21c1
Sequence:CCGCTCGGCTGACGAAAGCGCTATTCTCGAGAATAGCGCTTTCGTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-144s21c1
Sequence:CCGGGAGGATGAGTCTGCGCATTTGCTCGAGCAAATGCGCAGACTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-1300s21c1
Sequence:CCGGACATGGGCAAAGCGGTGTATGCTCGAGCATACACCGCTTTGCCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-1050s21c1
Sequence:CCGGGTAATAGGTGTTGTCATTTATCTCGAGATAAATGACAACACCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198531.3-3312s1c1
Sequence:CCGGGCTTTCTTAGATGTTGCCTTTCTCGAGAAAGGCAACATCTAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198531.3-585s1c1
Sequence:CCGGGCTGTTACTATGACACGGGAACTCGAGTTCCCGTGTCATAGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_198531.3-1027s1c1
Sequence:CCGGGCACCATTGTTGCATCAGGTACTCGAGTACCTGATGCAACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_198531.3-174s1c1
Sequence:CCGGCCACTAATGATGTCTGAAGAACTCGAGTTCTTCAGACATCATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_198531.3-1632s1c1
Sequence:CCGGCGAATCCATGAAGCCGTGAAACTCGAGTTTCACGGCTTCATGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198531
VALIDATED
ATP9B MISSION shRNA Lentiviral Transduction Particles
ATPase, class II, type 9B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-1148s21c1
Sequence:CCGCTCGGCTGACGAAAGCGCTATTCTCGAGAATAGCGCTTTCGTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-144s21c1
Sequence:CCGGGAGGATGAGTCTGCGCATTTGCTCGAGCAAATGCGCAGACTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-1300s21c1
Sequence:CCGGACATGGGCAAAGCGGTGTATGCTCGAGCATACACCGCTTTGCCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198531.3-1050s21c1
Sequence:CCGGGTAATAGGTGTTGTCATTTATCTCGAGATAAATGACAACACCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198531.3-3312s1c1
Sequence:CCGGGCTTTCTTAGATGTTGCCTTTCTCGAGAAAGGCAACATCTAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198531.3-585s1c1
Sequence:CCGGGCTGTTACTATGACACGGGAACTCGAGTTCCCGTGTCATAGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_198531.3-1027s1c1
Sequence:CCGGGCACCATTGTTGCATCAGGTACTCGAGTACCTGATGCAACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_198531.3-174s1c1
Sequence:CCGGCCACTAATGATGTCTGAAGAACTCGAGTTCTTCAGACATCATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_198531.3-1632s1c1
Sequence:CCGGCGAATCCATGAAGCCGTGAAACTCGAGTTTCACGGCTTCATGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015805
VALIDATED
ATP9B MISSION shRNA Bacterial Glycerol Stock
ATPase, class II, type 9B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015805.2-3795s21c1
Sequence:CCGGCGTCCTCTTCAGATGCAGTTTCTCGAGAAACTGCATCTGAAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-1252s21c1
Sequence:CCGGAGCTGACAAAGGCGCTATTTCCTCGAGGAAATAGCGCCTTTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-1590s21c1
Sequence:CCGGACGGACACTATGGACGAAATCCTCGAGGATTTCGTCCATAGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-409s21c1
Sequence:CCGGGTTGCTGTGATTGGCTAATAACTCGAGTTATTAGCCAATCACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-1376s21c1
Sequence:CCGGTCCCATAAGTCTGCGAGTAAACTCGAGTTTACTCGCAGACTTATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015805.2-3795s1c1
Sequence:CCGGCGTCCTCTTCAGATGCAGTTTCTCGAGAAACTGCATCTGAAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015805.2-710s1c1
Sequence:CCGGGATTGATGAATTTCGACGTTTCTCGAGAAACGTCGAAATTCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015805.2-616s1c1
Sequence:CCGGGCTCACAGTTTGTACCAGCATCTCGAGATGCTGGTACAAACTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015805.2-709s1c1
Sequence:CCGGCGATTGATGAATTTCGACGTTCTCGAGAACGTCGAAATTCATCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015805.2-2416s1c1
Sequence:CCGGGCGATAAACTGGAAACAGCTACTCGAGTAGCTGTTTCCAGTTTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015805
VALIDATED
ATP9B MISSION shRNA shRNA Plasmid DNA
ATPase, class II, type 9B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015805.2-3795s21c1
Sequence:CCGGCGTCCTCTTCAGATGCAGTTTCTCGAGAAACTGCATCTGAAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-1252s21c1
Sequence:CCGGAGCTGACAAAGGCGCTATTTCCTCGAGGAAATAGCGCCTTTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-1590s21c1
Sequence:CCGGACGGACACTATGGACGAAATCCTCGAGGATTTCGTCCATAGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-409s21c1
Sequence:CCGGGTTGCTGTGATTGGCTAATAACTCGAGTTATTAGCCAATCACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-1376s21c1
Sequence:CCGGTCCCATAAGTCTGCGAGTAAACTCGAGTTTACTCGCAGACTTATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015805.2-3795s1c1
Sequence:CCGGCGTCCTCTTCAGATGCAGTTTCTCGAGAAACTGCATCTGAAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015805.2-710s1c1
Sequence:CCGGGATTGATGAATTTCGACGTTTCTCGAGAAACGTCGAAATTCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015805.2-616s1c1
Sequence:CCGGGCTCACAGTTTGTACCAGCATCTCGAGATGCTGGTACAAACTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015805.2-709s1c1
Sequence:CCGGCGATTGATGAATTTCGACGTTCTCGAGAACGTCGAAATTCATCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015805.2-2416s1c1
Sequence:CCGGGCGATAAACTGGAAACAGCTACTCGAGTAGCTGTTTCCAGTTTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015805
VALIDATED
ATP9B MISSION shRNA Lentiviral Transduction Particles
ATPase, class II, type 9B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015805.2-3795s21c1
Sequence:CCGGCGTCCTCTTCAGATGCAGTTTCTCGAGAAACTGCATCTGAAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-1252s21c1
Sequence:CCGGAGCTGACAAAGGCGCTATTTCCTCGAGGAAATAGCGCCTTTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-1590s21c1
Sequence:CCGGACGGACACTATGGACGAAATCCTCGAGGATTTCGTCCATAGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-409s21c1
Sequence:CCGGGTTGCTGTGATTGGCTAATAACTCGAGTTATTAGCCAATCACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015805.2-1376s21c1
Sequence:CCGGTCCCATAAGTCTGCGAGTAAACTCGAGTTTACTCGCAGACTTATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015805.2-3795s1c1
Sequence:CCGGCGTCCTCTTCAGATGCAGTTTCTCGAGAAACTGCATCTGAAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015805.2-710s1c1
Sequence:CCGGGATTGATGAATTTCGACGTTTCTCGAGAAACGTCGAAATTCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015805.2-616s1c1
Sequence:CCGGGCTCACAGTTTGTACCAGCATCTCGAGATGCTGGTACAAACTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015805.2-709s1c1
Sequence:CCGGCGATTGATGAATTTCGACGTTCTCGAGAACGTCGAAATTCATCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015805.2-2416s1c1
Sequence:CCGGGCGATAAACTGGAAACAGCTACTCGAGTAGCTGTTTCCAGTTTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks