EMAIL THIS PAGE TO A FRIEND

ATPAF1

ATP synthase mitochondrial F1 complex assembly factor 1

173 Gene Product Result for
Synonyms: ATP11 ATP11p
UniProtKB ID: Q5TC12, B1AQW7, B7Z7D6, B7Z7I6, Q9H6E3
Gene ID:
Human(64756) Summary: This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 beta subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
Mouse(230649) ATP synthase mitochondrial F1 complex assembly factor 1
Rat(313510) ATP synthase mitochondrial F1 complex assembly factor 1
Zebrafish(550606) ATP synthase mitochondrial F1 complex assembly factor 1
cow(505430) ATP synthase mitochondrial F1 complex assembly factor 1
domestic cat(101083020) ATP synthase mitochondrial F1 complex assembly factor 1
dog(610408) ATP synthase mitochondrial F1 complex assembly factor 1
chicken(424616) ATP synthase mitochondrial F1 complex assembly factor 1
domestic guinea pig(100730688) ATP synthase mitochondrial F1 complex assembly factor 1
naked mole-rat(101724337) ATP synthase mitochondrial F1 complex assembly factor 1
sheep(101112620) ATP synthase mitochondrial F1 complex assembly factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022745 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042546 Rosetta Predictions human pricing
NM_022745 Rosetta Predictions human pricing
NM_001107959 Rosetta Predictions rat pricing
NM_181040 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310498 predicted 1252
2 SASI_Hs02_00310499 predicted 1372
3 SASI_Hs02_00310500 predicted 1348
4 SASI_Hs02_00310501 predicted 1024
5 SASI_Hs02_00310502 predicted 1034
6 SASI_Hs02_00310503 predicted 1213
7 SASI_Hs02_00310504 predicted 1149
8 SASI_Hs02_00310505 predicted 1288
9 SASI_Hs02_00310506 predicted 1222
10 SASI_Hs02_00310507 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355996 predicted 1450
2 SASI_Hs02_00355997 predicted 1583
3 SASI_Hs02_00355998 predicted 1553
4 SASI_Hs01_00025919 predicted 1234
5 SASI_Hs01_00025920 predicted 1238
6 SASI_Hs02_00355999 predicted 1412
7 SASI_Hs01_00025922 predicted 1358
8 SASI_Hs02_00356000 predicted 1493
9 SASI_Hs02_00356001 predicted 1426
10 SASI_Hs01_00025925 predicted 1156
11 SASI_Hs01_00025917 predicted 990
12 SASI_Hs01_00025918 predicted 554
13 SASI_Hs01_00025921 predicted 467
14 SASI_Hs01_00025923 predicted 885
15 SASI_Hs01_00025924 predicted 524
16 SASI_Hs01_00025926 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233975 predicted 881
2 SASI_Rn02_00233976 predicted 1116
3 SASI_Rn02_00233977 predicted 1040
4 SASI_Rn02_00233978 predicted 612
5 SASI_Rn02_00233979 predicted 708
6 SASI_Rn02_00233980 predicted 986
7 SASI_Rn02_00233981 predicted 1199
8 SASI_Rn02_00233982 predicted 753
9 SASI_Rn02_00233983 predicted 1174
10 SASI_Rn02_00233984 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192182 predicted 880
2 SASI_Mm01_00192183 predicted 543
3 SASI_Mm02_00349597 predicted 587
4 SASI_Mm01_00192184 predicted 1150
5 SASI_Mm01_00192185 predicted 1142
6 SASI_Mm01_00192186 predicted 839
7 SASI_Mm02_00349598 predicted 834
8 SASI_Mm01_00192187 predicted 952
9 SASI_Mm01_00192188 predicted 1016
10 SASI_Mm01_00192190 predicted 497
11 SASI_Mm01_00192189 predicted 959
12 SASI_Mm01_00192191 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181040
ATPAF1 MISSION shRNA Bacterial Glycerol Stock
ATP synthase mitochondrial F1 complex assembly factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181040.2-1440s1c1
Sequence:CCGGCCCACTTCTATGACTTCATAACTCGAGTTATGAAGTCATAGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-720s1c1
Sequence:CCGGGCTCCACTTCACTGCACTTATCTCGAGATAAGTGCAGTGAAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-835s1c1
Sequence:CCGGGCAGAAATGGACTCCACATTTCTCGAGAAATGTGGAGTCCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-1031s1c1
Sequence:CCGGCCCAGAACCAAGATAAGACTTCTCGAGAAGTCTTATCTTGGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-594s1c1
Sequence:CCGGCGCAGTTATTCCTAAAGAGAACTCGAGTTCTCTTTAGGAATAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181040
ATPAF1 MISSION shRNA shRNA Plasmid DNA
ATP synthase mitochondrial F1 complex assembly factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181040.2-1440s1c1
Sequence:CCGGCCCACTTCTATGACTTCATAACTCGAGTTATGAAGTCATAGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-720s1c1
Sequence:CCGGGCTCCACTTCACTGCACTTATCTCGAGATAAGTGCAGTGAAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-835s1c1
Sequence:CCGGGCAGAAATGGACTCCACATTTCTCGAGAAATGTGGAGTCCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-1031s1c1
Sequence:CCGGCCCAGAACCAAGATAAGACTTCTCGAGAAGTCTTATCTTGGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-594s1c1
Sequence:CCGGCGCAGTTATTCCTAAAGAGAACTCGAGTTCTCTTTAGGAATAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181040
ATPAF1 MISSION shRNA Lentiviral Transduction Particles
ATP synthase mitochondrial F1 complex assembly factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181040.2-1440s1c1
Sequence:CCGGCCCACTTCTATGACTTCATAACTCGAGTTATGAAGTCATAGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-720s1c1
Sequence:CCGGGCTCCACTTCACTGCACTTATCTCGAGATAAGTGCAGTGAAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-835s1c1
Sequence:CCGGGCAGAAATGGACTCCACATTTCTCGAGAAATGTGGAGTCCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-1031s1c1
Sequence:CCGGCCCAGAACCAAGATAAGACTTCTCGAGAAGTCTTATCTTGGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181040.2-594s1c1
Sequence:CCGGCGCAGTTATTCCTAAAGAGAACTCGAGTTCTCTTTAGGAATAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022745
VALIDATED
ATPAF1 MISSION shRNA Bacterial Glycerol Stock
ATP synthase mitochondrial F1 complex assembly factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-1530s1c1
Sequence:CCGGCCATCAGGTTAAAGACTTCATCTCGAGATGAAGTCTTTAACCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-336s1c1
Sequence:CCGGCCTGGAGAAACGCAGTGAATTCTCGAGAATTCACTGCGTTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022745.1-927s1c1
Sequence:CCGGCCTCAGACCAAATGAGTTCAACTCGAGTTGAACTCATTTGGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-811s1c1
Sequence:CCGGGCAGAAATGGATTCCACATTTCTCGAGAAATGTGGAATCCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-447s1c1
Sequence:CCGGCAGAGGATTCACTAAGGACAACTCGAGTTGTCCTTAGTGAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022745.3-1320s21c1
Sequence:CCGGTTTAAGTGTTCGAGGTTATAACTCGAGTTATAACCTCGAACACTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022745.3-621s21c1
Sequence:CCGGAGATACAGTCTACGCAGTTATCTCGAGATAACTGCGTAGACTGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022745.3-1015s21c1
Sequence:CCGGATGTCTGTCATCGCTGAATTGCTCGAGCAATTCAGCGATGACAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022745.3-1046s21c1
Sequence:CCGGGACTTGGAGCAGAACTGAAATCTCGAGATTTCAGTTCTGCTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022745
VALIDATED
ATPAF1 MISSION shRNA shRNA Plasmid DNA
ATP synthase mitochondrial F1 complex assembly factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-1530s1c1
Sequence:CCGGCCATCAGGTTAAAGACTTCATCTCGAGATGAAGTCTTTAACCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-336s1c1
Sequence:CCGGCCTGGAGAAACGCAGTGAATTCTCGAGAATTCACTGCGTTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022745.1-927s1c1
Sequence:CCGGCCTCAGACCAAATGAGTTCAACTCGAGTTGAACTCATTTGGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-811s1c1
Sequence:CCGGGCAGAAATGGATTCCACATTTCTCGAGAAATGTGGAATCCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-447s1c1
Sequence:CCGGCAGAGGATTCACTAAGGACAACTCGAGTTGTCCTTAGTGAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022745.3-1320s21c1
Sequence:CCGGTTTAAGTGTTCGAGGTTATAACTCGAGTTATAACCTCGAACACTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022745.3-621s21c1
Sequence:CCGGAGATACAGTCTACGCAGTTATCTCGAGATAACTGCGTAGACTGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022745.3-1015s21c1
Sequence:CCGGATGTCTGTCATCGCTGAATTGCTCGAGCAATTCAGCGATGACAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022745.3-1046s21c1
Sequence:CCGGGACTTGGAGCAGAACTGAAATCTCGAGATTTCAGTTCTGCTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022745
VALIDATED
ATPAF1 MISSION shRNA Lentiviral Transduction Particles
ATP synthase mitochondrial F1 complex assembly factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-1530s1c1
Sequence:CCGGCCATCAGGTTAAAGACTTCATCTCGAGATGAAGTCTTTAACCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-336s1c1
Sequence:CCGGCCTGGAGAAACGCAGTGAATTCTCGAGAATTCACTGCGTTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022745.1-927s1c1
Sequence:CCGGCCTCAGACCAAATGAGTTCAACTCGAGTTGAACTCATTTGGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-811s1c1
Sequence:CCGGGCAGAAATGGATTCCACATTTCTCGAGAAATGTGGAATCCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022745.1-447s1c1
Sequence:CCGGCAGAGGATTCACTAAGGACAACTCGAGTTGTCCTTAGTGAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022745.3-1320s21c1
Sequence:CCGGTTTAAGTGTTCGAGGTTATAACTCGAGTTATAACCTCGAACACTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022745.3-621s21c1
Sequence:CCGGAGATACAGTCTACGCAGTTATCTCGAGATAACTGCGTAGACTGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022745.3-1015s21c1
Sequence:CCGGATGTCTGTCATCGCTGAATTGCTCGAGCAATTCAGCGATGACAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022745.3-1046s21c1
Sequence:CCGGGACTTGGAGCAGAACTGAAATCTCGAGATTTCAGTTCTGCTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks