EMAIL THIS PAGE TO A FRIEND

ATPAF2

ATP synthase mitochondrial F1 complex assembly factor 2

51 Gene Product Result for
Synonyms: ATP12 ATP12p MC5DN1
UniProtKB ID: Q8N5M1, A6NDE5, A8K2J2, Q6XYC7
Gene ID:
Human(91647) Summary: This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 alpha subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. This gene is located within the Smith-Magenis syndrome region on chromosome 17. An alternatively spliced transcript variant has been described, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(246782) ATP synthase mitochondrial F1 complex assembly factor 2
Rat(303190) ATP synthase mitochondrial F1 complex assembly factor 2
Zebrafish(560253) ATP synthase mitochondrial F1 complex assembly factor 2
cow(513521) ATP synthase mitochondrial F1 complex assembly factor 2
domestic cat(101100764) ATP synthase mitochondrial F1 complex assembly factor 2
dog(489539) ATP synthase mitochondrial F1 complex assembly factor 2
chicken(416511) ATP synthase mitochondrial F1 complex assembly factor 2
sheep(101111895) ATP synthase mitochondrial F1 complex assembly factor 2
naked mole-rat(101700646) ATP synthase mitochondrial F1 complex assembly factor 2
domestic guinea pig(100732188) ATP synthase mitochondrial F1 complex assembly factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145691 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145691 Rosetta Predictions human pricing
NM_001107006 Rosetta Predictions rat pricing
NM_145427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060714 predicted 463
2 SASI_Hs01_00060715 predicted 751
3 SASI_Hs01_00060716 predicted 529
4 SASI_Hs01_00060717 predicted 813
5 SASI_Hs01_00060718 predicted 445
6 SASI_Hs01_00060719 predicted 612
7 SASI_Hs02_00365297 predicted 635
8 SASI_Hs02_00365298 predicted 1159
9 SASI_Hs01_00060721 predicted 1256
10 SASI_Hs01_00060723 predicted 743
11 SASI_Hs01_00060720 predicted 483
12 SASI_Hs01_00060722 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224556 predicted 996
2 SASI_Rn02_00224557 predicted 788
3 SASI_Rn02_00224558 predicted 1160
4 SASI_Rn02_00224559 predicted 270
5 SASI_Rn02_00224560 predicted 414
6 SASI_Rn02_00224561 predicted 814
7 SASI_Rn02_00224562 predicted 824
8 SASI_Rn02_00224563 predicted 450
9 SASI_Rn02_00224564 predicted 327
10 SASI_Rn02_00224565 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045522 predicted 236
2 SASI_Mm01_00045524 predicted 1286
3 SASI_Mm01_00045525 predicted 702
4 SASI_Mm01_00045526 predicted 784
5 SASI_Mm02_00340779 predicted 1078
6 SASI_Mm01_00045527 predicted 486
7 SASI_Mm01_00045528 predicted 420
8 SASI_Mm01_00045529 predicted 416
9 SASI_Mm01_00045531 predicted 760
10 SASI_Mm02_00340780 predicted 413
11 SASI_Mm01_00045523 predicted 236
12 SASI_Mm01_00045530 predicted 1176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145691
VALIDATED
ATPAF2 MISSION shRNA Bacterial Glycerol Stock
ATP synthase mitochondrial F1 complex assembly factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-486s21c1
Sequence:CCGGGTGCAACACATCATTGGACAACTCGAGTTGTCCAATGATGTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-592s21c1
Sequence:CCGGCCCGAGACATTAGTGGAACTTCTCGAGAAGTTCCACTAATGTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-742s21c1
Sequence:CCGGGCATCTTACAACACATGGGCTCTCGAGAGCCCATGTGTTGTAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-279s21c1
Sequence:CCGGGCCGACAGAAAGGAAGAGGTTCTCGAGAACCTCTTCCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-441s21c1
Sequence:CCGGCCAGCAGGATACCATCAAGTACTCGAGTACTTGATGGTATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-742s1c1
Sequence:CCGGGCATCTTACAACACATGGGCTCTCGAGAGCCCATGTGTTGTAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-441s1c1
Sequence:CCGGCCAGCAGGATACCATCAAGTACTCGAGTACTTGATGGTATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-486s1c1
Sequence:CCGGGTGCAACACATCATTGGACAACTCGAGTTGTCCAATGATGTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145691.2-592s1c1
Sequence:CCGGCCCGAGACATTAGTGGAACTTCTCGAGAAGTTCCACTAATGTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-279s1c1
Sequence:CCGGGCCGACAGAAAGGAAGAGGTTCTCGAGAACCTCTTCCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145691
VALIDATED
ATPAF2 MISSION shRNA shRNA Plasmid DNA
ATP synthase mitochondrial F1 complex assembly factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-486s21c1
Sequence:CCGGGTGCAACACATCATTGGACAACTCGAGTTGTCCAATGATGTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-592s21c1
Sequence:CCGGCCCGAGACATTAGTGGAACTTCTCGAGAAGTTCCACTAATGTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-742s21c1
Sequence:CCGGGCATCTTACAACACATGGGCTCTCGAGAGCCCATGTGTTGTAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-279s21c1
Sequence:CCGGGCCGACAGAAAGGAAGAGGTTCTCGAGAACCTCTTCCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-441s21c1
Sequence:CCGGCCAGCAGGATACCATCAAGTACTCGAGTACTTGATGGTATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-742s1c1
Sequence:CCGGGCATCTTACAACACATGGGCTCTCGAGAGCCCATGTGTTGTAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-441s1c1
Sequence:CCGGCCAGCAGGATACCATCAAGTACTCGAGTACTTGATGGTATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-486s1c1
Sequence:CCGGGTGCAACACATCATTGGACAACTCGAGTTGTCCAATGATGTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145691.2-592s1c1
Sequence:CCGGCCCGAGACATTAGTGGAACTTCTCGAGAAGTTCCACTAATGTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-279s1c1
Sequence:CCGGGCCGACAGAAAGGAAGAGGTTCTCGAGAACCTCTTCCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145691
VALIDATED
ATPAF2 MISSION shRNA Lentiviral Transduction Particles
ATP synthase mitochondrial F1 complex assembly factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-486s21c1
Sequence:CCGGGTGCAACACATCATTGGACAACTCGAGTTGTCCAATGATGTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-592s21c1
Sequence:CCGGCCCGAGACATTAGTGGAACTTCTCGAGAAGTTCCACTAATGTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-742s21c1
Sequence:CCGGGCATCTTACAACACATGGGCTCTCGAGAGCCCATGTGTTGTAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-279s21c1
Sequence:CCGGGCCGACAGAAAGGAAGAGGTTCTCGAGAACCTCTTCCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145691.3-441s21c1
Sequence:CCGGCCAGCAGGATACCATCAAGTACTCGAGTACTTGATGGTATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-742s1c1
Sequence:CCGGGCATCTTACAACACATGGGCTCTCGAGAGCCCATGTGTTGTAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-441s1c1
Sequence:CCGGCCAGCAGGATACCATCAAGTACTCGAGTACTTGATGGTATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-486s1c1
Sequence:CCGGGTGCAACACATCATTGGACAACTCGAGTTGTCCAATGATGTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145691.2-592s1c1
Sequence:CCGGCCCGAGACATTAGTGGAACTTCTCGAGAAGTTCCACTAATGTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145691.2-279s1c1
Sequence:CCGGGCCGACAGAAAGGAAGAGGTTCTCGAGAACCTCTTCCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145427
VALIDATED
ATPAF2 MISSION shRNA Bacterial Glycerol Stock
ATP synthase mitochondrial F1 complex assembly factor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145427.1-1422s1c1
Sequence:CCGGCCATTATTACATCTGCTACTACTCGAGTAGTAGCAGATGTAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145427.1-455s1c1
Sequence:CCGGGTGCAACACATCCTTGGACAACTCGAGTTGTCCAAGGATGTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145427.1-445s1c1
Sequence:CCGGTGACCACATTGTGCAACACATCTCGAGATGTGTTGCACAATGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145427.1-561s1c1
Sequence:CCGGCCAGAGACATTAGTGGAACTTCTCGAGAAGTTCCACTAATGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145427.1-704s1c1
Sequence:CCGGCCACTTGTCCTCTTACAACATCTCGAGATGTTGTAAGAGGACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145427
VALIDATED
ATPAF2 MISSION shRNA shRNA Plasmid DNA
ATP synthase mitochondrial F1 complex assembly factor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145427.1-1422s1c1
Sequence:CCGGCCATTATTACATCTGCTACTACTCGAGTAGTAGCAGATGTAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145427.1-455s1c1
Sequence:CCGGGTGCAACACATCCTTGGACAACTCGAGTTGTCCAAGGATGTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145427.1-445s1c1
Sequence:CCGGTGACCACATTGTGCAACACATCTCGAGATGTGTTGCACAATGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145427.1-561s1c1
Sequence:CCGGCCAGAGACATTAGTGGAACTTCTCGAGAAGTTCCACTAATGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145427.1-704s1c1
Sequence:CCGGCCACTTGTCCTCTTACAACATCTCGAGATGTTGTAAGAGGACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145427
VALIDATED
ATPAF2 MISSION shRNA Lentiviral Transduction Particles
ATP synthase mitochondrial F1 complex assembly factor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145427.1-1422s1c1
Sequence:CCGGCCATTATTACATCTGCTACTACTCGAGTAGTAGCAGATGTAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145427.1-455s1c1
Sequence:CCGGGTGCAACACATCCTTGGACAACTCGAGTTGTCCAAGGATGTGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145427.1-445s1c1
Sequence:CCGGTGACCACATTGTGCAACACATCTCGAGATGTGTTGCACAATGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145427.1-561s1c1
Sequence:CCGGCCAGAGACATTAGTGGAACTTCTCGAGAAGTTCCACTAATGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145427.1-704s1c1
Sequence:CCGGCCACTTGTCCTCTTACAACATCTCGAGATGTTGTAAGAGGACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks