EMAIL THIS PAGE TO A FRIEND

ATPIF1

ATPase inhibitory factor 1

Synonyms: ATPI ATPIP IP
UniProtKB ID: Q9UII2, Q5JXL8, Q6IAQ7, Q9BSL9
Gene ID:
Human(93974) Summary: This gene encodes a mitochondrial ATPase inhibitor. Alternative splicing occurs at this locus and three transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(11983) ATPase inhibitory factor 1
Rat(25392) ATPase inhibitory factor 1
dog(478165) ATPase inhibitory factor 1
domestic cat(101086407) ATPase inhibitory factor 1
cow(327699) ATPase inhibitory factor 1
sheep(101110916) ATPase inhibitory factor 1
domestic guinea pig(100720150) ATPase inhibitory factor 1
naked mole-rat(101712500) ATPase inhibitory factor 1
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016311 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016311 Rosetta Predictions human pricing
NM_178190 Rosetta Predictions human pricing
NM_178191 Rosetta Predictions human pricing
NM_012915 Rosetta Predictions rat pricing
NM_007512 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230331 predicted 276
2 SASI_Hs01_00230332 predicted 249
3 SASI_Hs01_00230333 predicted 235
4 SASI_Hs01_00230334 predicted 233
5 SASI_Hs01_00230335 predicted 293
6 SASI_Hs01_00230336 predicted 238
7 SASI_Hs01_00230337 predicted 259
8 SASI_Hs01_00230338 predicted 246
9 SASI_Hs01_00230339 predicted 230
10 SASI_Hs01_00230340 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178337 predicted 348
2 SASI_Hs01_00178338 predicted 310
3 SASI_Hs01_00178339 predicted 372
4 SASI_Hs01_00178340 predicted 321
5 SASI_Hs01_00178341 predicted 231
6 SASI_Hs01_00178343 predicted 234
7 SASI_Hs02_00369595 predicted 255
8 SASI_Hs01_00178344 predicted 258
9 SASI_Hs01_00178345 predicted 325
10 SASI_Hs01_00178346 predicted 268
11 SASI_Hs01_00178342 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132134 predicted 516
2 SASI_Hs02_00369596 predicted 443
3 SASI_Hs01_00132135 predicted 449
4 SASI_Hs01_00132136 predicted 425
5 SASI_Hs01_00132137 predicted 518
6 SASI_Hs01_00132138 predicted 236
7 SASI_Hs01_00132139 predicted 246
8 SASI_Hs01_00132140 predicted 398
9 SASI_Hs01_00132141 predicted 693
10 SASI_Hs01_00132142 predicted 596
11 SASI_Hs01_00132143 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087287 predicted 213
2 SASI_Rn01_00087288 predicted 201
3 SASI_Rn01_00087289 predicted 229
4 SASI_Rn01_00087290 predicted 197
5 SASI_Rn01_00087286 predicted 242
6 SASI_Rn01_00087291 predicted 252
7 SASI_Rn01_00087292 predicted 241
8 SASI_Rn01_00087293 predicted 251
9 SASI_Rn02_00260451 predicted 235
10 SASI_Rn01_00087294 predicted 210
11 SASI_Rn01_00087295 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024532 predicted 241
2 SASI_Mm01_00024533 predicted 207
3 SASI_Mm01_00024534 predicted 286
4 SASI_Mm01_00024535 predicted 251
5 SASI_Mm01_00024536 predicted 300
6 SASI_Mm01_00024537 predicted 243
7 SASI_Mm01_00024538 predicted 265
8 SASI_Mm01_00024539 predicted 206
9 SASI_Mm01_00024540 predicted 248
10 SASI_Mm01_00024541 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016311
VALIDATED
ATPIF1 MISSION shRNA Bacterial Glycerol Stock
ATPase inhibitory factor 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-301s1c1
Sequence:CCGGCACCATGAAGAAGAAATCGTTCTCGAGAACGATTTCTTCTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016311.3-318s1c1
Sequence:CCGGCGTTCATCATAAGAAGGAGATCTCGAGATCTCCTTCTTATGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_016311.3-303s1c1
Sequence:CCGGCCATGAAGAAGAAATCGTTCACTCGAGTGAACGATTTCTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016311.3-351s1c1
Sequence:CCGGGAAAGAAATTGAGCGCCATAACTCGAGTTATGGCGCTCAATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_016311.3-364s1c1
Sequence:CCGGCGCCATAAGCAGAAGATCAAACTCGAGTTTGATCTTCTGCTTATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-254s1c1
Sequence:CCGGGATATTTCCGAGCACAGAGTACTCGAGTACTCTGTGCTCGGAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-244s1c1
Sequence:CCGGGAAGAGGAACGATATTTCCGACTCGAGTCGGAAATATCGTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-340s1c1
Sequence:CCGGGAGCGTCTGCAGAAAGAAATTCTCGAGAATTTCTTTCTGCAGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_016311.3-349s1c1
Sequence:CCGGCAGAAAGAAATTGAGCGCCATCTCGAGATGGCGCTCAATTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-263s21c1
Sequence:CCGGGAGCACAGAGTAGAGAACAACCTCGAGGTTGTTCTCTACTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-167s21c1
Sequence:CCGGATCAGTCCGAGAATGTCGACCCTCGAGGGTCGACATTCTCGGACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-332s21c1
Sequence:CCGGAGGAGATTGAGCGTCTGCAGACTCGAGTCTGCAGACGCTCAATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-272s21c1
Sequence:CCGGGTAGAGAACAACTGGCAGCTTCTCGAGAAGCTGCCAGTTGTTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-227s21c1
Sequence:CCGGGAAAGAGAGAGCAGGCTGAAGCTCGAGCTTCAGCCTGCTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016311
VALIDATED
ATPIF1 MISSION shRNA shRNA Plasmid DNA
ATPase inhibitory factor 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-301s1c1
Sequence:CCGGCACCATGAAGAAGAAATCGTTCTCGAGAACGATTTCTTCTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016311.3-318s1c1
Sequence:CCGGCGTTCATCATAAGAAGGAGATCTCGAGATCTCCTTCTTATGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_016311.3-303s1c1
Sequence:CCGGCCATGAAGAAGAAATCGTTCACTCGAGTGAACGATTTCTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016311.3-351s1c1
Sequence:CCGGGAAAGAAATTGAGCGCCATAACTCGAGTTATGGCGCTCAATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_016311.3-364s1c1
Sequence:CCGGCGCCATAAGCAGAAGATCAAACTCGAGTTTGATCTTCTGCTTATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-254s1c1
Sequence:CCGGGATATTTCCGAGCACAGAGTACTCGAGTACTCTGTGCTCGGAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-244s1c1
Sequence:CCGGGAAGAGGAACGATATTTCCGACTCGAGTCGGAAATATCGTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-340s1c1
Sequence:CCGGGAGCGTCTGCAGAAAGAAATTCTCGAGAATTTCTTTCTGCAGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_016311.3-349s1c1
Sequence:CCGGCAGAAAGAAATTGAGCGCCATCTCGAGATGGCGCTCAATTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-263s21c1
Sequence:CCGGGAGCACAGAGTAGAGAACAACCTCGAGGTTGTTCTCTACTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-167s21c1
Sequence:CCGGATCAGTCCGAGAATGTCGACCCTCGAGGGTCGACATTCTCGGACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-332s21c1
Sequence:CCGGAGGAGATTGAGCGTCTGCAGACTCGAGTCTGCAGACGCTCAATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-272s21c1
Sequence:CCGGGTAGAGAACAACTGGCAGCTTCTCGAGAAGCTGCCAGTTGTTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-227s21c1
Sequence:CCGGGAAAGAGAGAGCAGGCTGAAGCTCGAGCTTCAGCCTGCTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016311
VALIDATED
ATPIF1 MISSION shRNA Lentiviral Transduction Particles
ATPase inhibitory factor 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-301s1c1
Sequence:CCGGCACCATGAAGAAGAAATCGTTCTCGAGAACGATTTCTTCTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016311.3-318s1c1
Sequence:CCGGCGTTCATCATAAGAAGGAGATCTCGAGATCTCCTTCTTATGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_016311.3-303s1c1
Sequence:CCGGCCATGAAGAAGAAATCGTTCACTCGAGTGAACGATTTCTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016311.3-351s1c1
Sequence:CCGGGAAAGAAATTGAGCGCCATAACTCGAGTTATGGCGCTCAATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_016311.3-364s1c1
Sequence:CCGGCGCCATAAGCAGAAGATCAAACTCGAGTTTGATCTTCTGCTTATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-254s1c1
Sequence:CCGGGATATTTCCGAGCACAGAGTACTCGAGTACTCTGTGCTCGGAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-244s1c1
Sequence:CCGGGAAGAGGAACGATATTTCCGACTCGAGTCGGAAATATCGTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016311.3-340s1c1
Sequence:CCGGGAGCGTCTGCAGAAAGAAATTCTCGAGAATTTCTTTCTGCAGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_016311.3-349s1c1
Sequence:CCGGCAGAAAGAAATTGAGCGCCATCTCGAGATGGCGCTCAATTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-263s21c1
Sequence:CCGGGAGCACAGAGTAGAGAACAACCTCGAGGTTGTTCTCTACTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-167s21c1
Sequence:CCGGATCAGTCCGAGAATGTCGACCCTCGAGGGTCGACATTCTCGGACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-332s21c1
Sequence:CCGGAGGAGATTGAGCGTCTGCAGACTCGAGTCTGCAGACGCTCAATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-272s21c1
Sequence:CCGGGTAGAGAACAACTGGCAGCTTCTCGAGAAGCTGCCAGTTGTTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016311.3-227s21c1
Sequence:CCGGGAAAGAGAGAGCAGGCTGAAGCTCGAGCTTCAGCCTGCTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007512
VALIDATED
ATPIF1 MISSION shRNA Bacterial Glycerol Stock
ATPase inhibitory factor 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007512.2-297s1c1
Sequence:CCGGCTGAGGAAACACCATGAAGATCTCGAGATCTTCATGGTGTTTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007512.2-324s1c1
Sequence:CCGGGACCACCATTCGAAGGAGATACTCGAGTATCTCCTTCGAATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007512.2-348s1c1
Sequence:CCGGCGTCTGCAGAAGCAAATTGAACTCGAGTTCAATTTGCTTCTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007512.2-353s1c1
Sequence:CCGGGCAGAAGCAAATTGAACGCCACTCGAGTGGCGTTCAATTTGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007512.2-456s1c1
Sequence:CCGGCGTCTGTAGACACATGGCTTTCTCGAGAAAGCCATGTGTCTACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007512.2-263s1c1
Sequence:CCGGCTTCCGAGAGAAGACTAAAGACTCGAGTCTTTAGTCTTCTCTCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-261s21c1
Sequence:CCGGTACTTCCGAGAGAAGACTAAACTCGAGTTTAGTCTTCTCTCGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-348s21c1
Sequence:CCGGCGTCTGCAGAAGCAAATTGAACTCGAGTTCAATTTGCTTCTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-456s21c1
Sequence:CCGGCGTCTGTAGACACATGGCTTTCTCGAGAAAGCCATGTGTCTACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-173s21c1
Sequence:CCGGCTCGTCGGATAGCATGGATACCTCGAGGTATCCATGCTATCCGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.3-264s21c1
Sequence:CCGGACTTCCGAGAGAAGACTAAAGCTCGAGCTTTAGTCTTCTCTCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007512.3-326s21c1
Sequence:CCGGGACCACCATTCGAAGGAGATACTCGAGTATCTCCTTCGAATGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007512
VALIDATED
ATPIF1 MISSION shRNA shRNA Plasmid DNA
ATPase inhibitory factor 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007512.2-297s1c1
Sequence:CCGGCTGAGGAAACACCATGAAGATCTCGAGATCTTCATGGTGTTTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007512.2-324s1c1
Sequence:CCGGGACCACCATTCGAAGGAGATACTCGAGTATCTCCTTCGAATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007512.2-348s1c1
Sequence:CCGGCGTCTGCAGAAGCAAATTGAACTCGAGTTCAATTTGCTTCTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007512.2-353s1c1
Sequence:CCGGGCAGAAGCAAATTGAACGCCACTCGAGTGGCGTTCAATTTGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007512.2-456s1c1
Sequence:CCGGCGTCTGTAGACACATGGCTTTCTCGAGAAAGCCATGTGTCTACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007512.2-263s1c1
Sequence:CCGGCTTCCGAGAGAAGACTAAAGACTCGAGTCTTTAGTCTTCTCTCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-261s21c1
Sequence:CCGGTACTTCCGAGAGAAGACTAAACTCGAGTTTAGTCTTCTCTCGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-348s21c1
Sequence:CCGGCGTCTGCAGAAGCAAATTGAACTCGAGTTCAATTTGCTTCTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-456s21c1
Sequence:CCGGCGTCTGTAGACACATGGCTTTCTCGAGAAAGCCATGTGTCTACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-173s21c1
Sequence:CCGGCTCGTCGGATAGCATGGATACCTCGAGGTATCCATGCTATCCGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.3-264s21c1
Sequence:CCGGACTTCCGAGAGAAGACTAAAGCTCGAGCTTTAGTCTTCTCTCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007512.3-326s21c1
Sequence:CCGGGACCACCATTCGAAGGAGATACTCGAGTATCTCCTTCGAATGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007512
VALIDATED
ATPIF1 MISSION shRNA Lentiviral Transduction Particles
ATPase inhibitory factor 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007512.2-297s1c1
Sequence:CCGGCTGAGGAAACACCATGAAGATCTCGAGATCTTCATGGTGTTTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007512.2-324s1c1
Sequence:CCGGGACCACCATTCGAAGGAGATACTCGAGTATCTCCTTCGAATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007512.2-348s1c1
Sequence:CCGGCGTCTGCAGAAGCAAATTGAACTCGAGTTCAATTTGCTTCTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007512.2-353s1c1
Sequence:CCGGGCAGAAGCAAATTGAACGCCACTCGAGTGGCGTTCAATTTGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007512.2-456s1c1
Sequence:CCGGCGTCTGTAGACACATGGCTTTCTCGAGAAAGCCATGTGTCTACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007512.2-263s1c1
Sequence:CCGGCTTCCGAGAGAAGACTAAAGACTCGAGTCTTTAGTCTTCTCTCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-261s21c1
Sequence:CCGGTACTTCCGAGAGAAGACTAAACTCGAGTTTAGTCTTCTCTCGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-348s21c1
Sequence:CCGGCGTCTGCAGAAGCAAATTGAACTCGAGTTCAATTTGCTTCTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-456s21c1
Sequence:CCGGCGTCTGTAGACACATGGCTTTCTCGAGAAAGCCATGTGTCTACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.2-173s21c1
Sequence:CCGGCTCGTCGGATAGCATGGATACCTCGAGGTATCCATGCTATCCGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007512.3-264s21c1
Sequence:CCGGACTTCCGAGAGAAGACTAAAGCTCGAGCTTTAGTCTTCTCTCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007512.3-326s21c1
Sequence:CCGGGACCACCATTCGAAGGAGATACTCGAGTATCTCCTTCGAATGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks