EMAIL THIS PAGE TO A FRIEND

ATR

ataxia telangiectasia and Rad3 related

71 Gene Product Result for
Synonyms: FCTCS FRP1 MEC1 SCKL SCKL1
UniProtKB ID: Q13535, Q59HB2, Q7KYL3, Q93051, Q9BXK4
Gene ID:
Human(545) Summary: The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
Mouse(245000) ataxia telangiectasia and Rad3 related
Rat(685055) ataxia telangiectasia and Rad3 related
Zebrafish(567770) ataxia telangiectasia and Rad3 related
cow(504869) ataxia telangiectasia and Rad3 related
Horse(100062529) ataxia telangiectasia and Rad3 related
domestic cat(101088023) ataxia telangiectasia and Rad3 related
dog(477101) ataxia telangiectasia and Rad3 related
chicken(424777) ataxia telangiectasia and Rad3 related
Thale Cress(834082) serine/threonine-protein kinase ATR
naked mole-rat(101701996) ataxia telangiectasia and Rad3 related
domestic guinea pig(100732693) ataxia telangiectasia and Rad3 related
sheep(101106566) ataxia telangiectasia and Rad3 related
Domestic Rabbit(100359062) ataxia telangiectasia and Rad3 related
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001184 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_147046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_147046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_147046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001184 siRNAs that have been validated in the lab human pricing
XM_001062084 Rosetta Predictions rat pricing
NM_019864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001184 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176271 validated 7453
1 SASI_Hs01_00176270 validated 4819
2 SASI_Hs01_00176272 predicted 6673
3 SASI_Hs01_00176274 predicted 6551
4 SASI_Hs01_00176275 predicted 7921
5 SASI_Hs01_00176277 predicted 6129
6 SASI_Hs01_00176278 predicted 6371
7 SASI_Hs02_00331315 predicted 3154
8 SASI_Hs02_00331316 predicted 5935
9 SASI_Hs02_00331317 predicted 753
10 SASI_Hs01_00176273 predicted 5328
11 SASI_Hs01_00176276 predicted 3511
12 SASI_Hs01_00176279 predicted 6815
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302367 predicted 2124
2 SASI_Rn02_00302368 predicted 1182
3 SASI_Rn02_00302369 predicted 228
4 SASI_Rn02_00302370 predicted 1235
5 SASI_Rn02_00302371 predicted 1558
6 SASI_Rn02_00302372 predicted 5632
7 SASI_Rn02_00302373 predicted 6357
8 SASI_Rn02_00302374 predicted 560
9 SASI_Rn02_00302375 predicted 5422
10 SASI_Rn02_00302376 predicted 5923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325149 predicted 7239
2 SASI_Mm02_00325150 predicted 4723
3 SASI_Mm02_00325151 predicted 3157
4 SASI_Mm02_00325152 predicted 1709
5 SASI_Mm02_00325153 predicted 7451
6 SASI_Mm02_00325154 predicted 5192
7 SASI_Mm02_00325155 predicted 875
8 SASI_Mm02_00325156 predicted 1551
9 SASI_Mm02_00325157 predicted 5089
10 SASI_Mm02_00325158 predicted 3339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001184
VALIDATED
ATR MISSION shRNA Bacterial Glycerol Stock
ataxia telangiectasia and Rad3 related
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001184.3-669s21c1
Sequence:CCGGGATGAACACATGGGATATTTACTCGAGTAAATATCCCATGTGTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001184.3-314s21c1
Sequence:CCGGCTCCGTGATGTTGCTTGATTTCTCGAGAAATCAAGCAACATCACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001184.3-248s21c1
Sequence:CCGGCCGGATACTTACAGATGTAAACTCGAGTTTACATCTGTAAGTATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.3-314s1c1
Sequence:CCGGCTCCGTGATGTTGCTTGATTTCTCGAGAAATCAAGCAACATCACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.3-751s1c1
Sequence:CCGGTAATGGTTCTTACTCGTATTACTCGAGTAATACGAGTAAGAACCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001184.3-8116s21c1
Sequence:CCGGCTGTGGTTGTATCTGTTCAATCTCGAGATTGAACAGATACAACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.2-8079s1c1
Sequence:CCGGGTAATGCATTTGGTATGAATCCTCGAGGATTCATACCAAATGCATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001184.2-5637s1c1
Sequence:CCGGCCAACGAGGATATGAATATATCTCGAGATATATTCATATCCTCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.2-652s1c1
Sequence:CCGGGATGAACACATGGGATATTTACTCGAGTAAATATCCCATGTGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001184.2-8099s1c1
Sequence:CCGGCTGTGGTTGTATCTGTTCAATCTCGAGATTGAACAGATACAACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001184.2-3463s1c1
Sequence:CCGGGCTGATTATTTACAACCCAAACTCGAGTTTGGGTTGTAAATAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001184.2-1945s1c1
Sequence:CCGGGCCGCTAATCTTCTAACATTACTCGAGTAATGTTAGAAGATTAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001184.x-1254s1c1
Sequence:CCGGAAAGAGGCTCCTACCAACGACTCGAGTCGTTGGTAGGAGCCTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001184.x-3426s1c1
Sequence:CCGGAATGGAGTAAACCAGTGAAACTCGAGTTTCACTGGTTTACTCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001184.x-8081s1c1
Sequence:CCGGAATGCATTTGGTATGAATCTGCTCGAGCAGATTCATACCAAATGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001184
VALIDATED
ATR MISSION shRNA shRNA Plasmid DNA
ataxia telangiectasia and Rad3 related
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001184.3-669s21c1
Sequence:CCGGGATGAACACATGGGATATTTACTCGAGTAAATATCCCATGTGTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001184.3-314s21c1
Sequence:CCGGCTCCGTGATGTTGCTTGATTTCTCGAGAAATCAAGCAACATCACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001184.3-248s21c1
Sequence:CCGGCCGGATACTTACAGATGTAAACTCGAGTTTACATCTGTAAGTATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.3-314s1c1
Sequence:CCGGCTCCGTGATGTTGCTTGATTTCTCGAGAAATCAAGCAACATCACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.3-751s1c1
Sequence:CCGGTAATGGTTCTTACTCGTATTACTCGAGTAATACGAGTAAGAACCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001184.3-8116s21c1
Sequence:CCGGCTGTGGTTGTATCTGTTCAATCTCGAGATTGAACAGATACAACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.2-8079s1c1
Sequence:CCGGGTAATGCATTTGGTATGAATCCTCGAGGATTCATACCAAATGCATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001184.2-5637s1c1
Sequence:CCGGCCAACGAGGATATGAATATATCTCGAGATATATTCATATCCTCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.2-652s1c1
Sequence:CCGGGATGAACACATGGGATATTTACTCGAGTAAATATCCCATGTGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001184.2-8099s1c1
Sequence:CCGGCTGTGGTTGTATCTGTTCAATCTCGAGATTGAACAGATACAACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001184.2-3463s1c1
Sequence:CCGGGCTGATTATTTACAACCCAAACTCGAGTTTGGGTTGTAAATAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001184.2-1945s1c1
Sequence:CCGGGCCGCTAATCTTCTAACATTACTCGAGTAATGTTAGAAGATTAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001184.x-1254s1c1
Sequence:CCGGAAAGAGGCTCCTACCAACGACTCGAGTCGTTGGTAGGAGCCTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001184.x-3426s1c1
Sequence:CCGGAATGGAGTAAACCAGTGAAACTCGAGTTTCACTGGTTTACTCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001184.x-8081s1c1
Sequence:CCGGAATGCATTTGGTATGAATCTGCTCGAGCAGATTCATACCAAATGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001184
VALIDATED
ATR MISSION shRNA Lentiviral Transduction Particles
ataxia telangiectasia and Rad3 related
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001184.3-669s21c1
Sequence:CCGGGATGAACACATGGGATATTTACTCGAGTAAATATCCCATGTGTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001184.3-314s21c1
Sequence:CCGGCTCCGTGATGTTGCTTGATTTCTCGAGAAATCAAGCAACATCACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001184.3-248s21c1
Sequence:CCGGCCGGATACTTACAGATGTAAACTCGAGTTTACATCTGTAAGTATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.3-314s1c1
Sequence:CCGGCTCCGTGATGTTGCTTGATTTCTCGAGAAATCAAGCAACATCACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.3-751s1c1
Sequence:CCGGTAATGGTTCTTACTCGTATTACTCGAGTAATACGAGTAAGAACCATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001184.3-8116s21c1
Sequence:CCGGCTGTGGTTGTATCTGTTCAATCTCGAGATTGAACAGATACAACCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.2-8079s1c1
Sequence:CCGGGTAATGCATTTGGTATGAATCCTCGAGGATTCATACCAAATGCATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001184.2-5637s1c1
Sequence:CCGGCCAACGAGGATATGAATATATCTCGAGATATATTCATATCCTCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001184.2-652s1c1
Sequence:CCGGGATGAACACATGGGATATTTACTCGAGTAAATATCCCATGTGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001184.2-8099s1c1
Sequence:CCGGCTGTGGTTGTATCTGTTCAATCTCGAGATTGAACAGATACAACCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001184.2-3463s1c1
Sequence:CCGGGCTGATTATTTACAACCCAAACTCGAGTTTGGGTTGTAAATAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001184.2-1945s1c1
Sequence:CCGGGCCGCTAATCTTCTAACATTACTCGAGTAATGTTAGAAGATTAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001184.x-1254s1c1
Sequence:CCGGAAAGAGGCTCCTACCAACGACTCGAGTCGTTGGTAGGAGCCTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001184.x-3426s1c1
Sequence:CCGGAATGGAGTAAACCAGTGAAACTCGAGTTTCACTGGTTTACTCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001184.x-8081s1c1
Sequence:CCGGAATGCATTTGGTATGAATCTGCTCGAGCAGATTCATACCAAATGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_147046
ATR MISSION shRNA Bacterial Glycerol Stock
ataxia telangiectasia and Rad3 related
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-1111s1c1
Sequence:CCGGCATTCCCTGATCCTACATCATCTCGAGATGATGTAGGATCAGGGAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-482s1c1
Sequence:CCGGCGATGGAAGCAATTCCACATTCTCGAGAATGTGGAATTGCTTCCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-908s1c1
Sequence:CCGGGATTATTGAATGGGTGAACAACTCGAGTTGTTCACCCATTCAATAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-879s1c1
Sequence:CCGGGCAGTTATTCCACTGAATGATCTCGAGATCATTCAGTGGAATAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-455s1c1
Sequence:CCGGGCTACTAGAATTATGCAACAACTCGAGTTGTTGCATAATTCTAGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_147046
ATR MISSION shRNA shRNA Plasmid DNA
ataxia telangiectasia and Rad3 related
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-1111s1c1
Sequence:CCGGCATTCCCTGATCCTACATCATCTCGAGATGATGTAGGATCAGGGAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-482s1c1
Sequence:CCGGCGATGGAAGCAATTCCACATTCTCGAGAATGTGGAATTGCTTCCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-908s1c1
Sequence:CCGGGATTATTGAATGGGTGAACAACTCGAGTTGTTCACCCATTCAATAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-879s1c1
Sequence:CCGGGCAGTTATTCCACTGAATGATCTCGAGATCATTCAGTGGAATAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-455s1c1
Sequence:CCGGGCTACTAGAATTATGCAACAACTCGAGTTGTTGCATAATTCTAGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_147046
ATR MISSION shRNA Lentiviral Transduction Particles
ataxia telangiectasia and Rad3 related
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-1111s1c1
Sequence:CCGGCATTCCCTGATCCTACATCATCTCGAGATGATGTAGGATCAGGGAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-482s1c1
Sequence:CCGGCGATGGAAGCAATTCCACATTCTCGAGAATGTGGAATTGCTTCCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-908s1c1
Sequence:CCGGGATTATTGAATGGGTGAACAACTCGAGTTGTTCACCCATTCAATAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-879s1c1
Sequence:CCGGGCAGTTATTCCACTGAATGATCTCGAGATCATTCAGTGGAATAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147046.2-455s1c1
Sequence:CCGGGCTACTAGAATTATGCAACAACTCGAGTTGTTGCATAATTCTAGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)