EMAIL THIS PAGE TO A FRIEND

ATRAID

all-trans retinoic acid-induced differentiation factor

91 Gene Product Result for
Synonyms: APR--3 APR-3 APR3 C2orf28 PRO240 p18
Gene ID:
Human(51374) Summary: This gene is thought to be involved in apoptosis, and may also be involved in hematopoietic development and differentiation. The use of alternative splice sites and promotors result in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2009]
Mouse(381629) all-trans retinoic acid induced differentiation factor
Rat(298841) all-trans retinoic acid-induced differentiation factor
Zebrafish(553468) all-trans retinoic acid-induced differentiation factor
domestic cat(101100124) all-trans retinoic acid-induced differentiation factor
dog(475699) all-trans retinoic acid-induced differentiation factor
sheep(101115524) all-trans retinoic acid-induced differentiation factor
domestic guinea pig(100726854) all-trans retinoic acid-induced differentiation factor
naked mole-rat(101708717) all-trans retinoic acid-induced differentiation factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016085 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016085 Rosetta Predictions human pricing
NM_080592 Rosetta Predictions human pricing
NM_001127526 Rosetta Predictions rat pricing
NM_027855 Rosetta Predictions mouse pricing
NM_212470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348835 predicted 830
2 SASI_Hs01_00037589 predicted 953
3 SASI_Hs01_00037590 predicted 797
4 SASI_Hs01_00037591 predicted 1062
5 SASI_Hs02_00348836 predicted 859
6 SASI_Hs01_00037592 predicted 886
7 SASI_Hs01_00037593 predicted 1065
8 SASI_Hs01_00037595 predicted 1109
9 SASI_Hs02_00348837 predicted 814
10 SASI_Hs01_00037596 predicted 1066
11 SASI_Hs01_00037594 predicted 1034
12 SASI_Hs01_00037597 predicted 876
13 SASI_Hs01_00037598 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362321 predicted 697
2 SASI_Hs01_00184512 predicted 817
3 SASI_Hs01_00184513 predicted 659
4 SASI_Hs01_00184514 predicted 915
5 SASI_Hs02_00362322 predicted 714
6 SASI_Hs01_00184515 predicted 743
7 SASI_Hs01_00184516 predicted 923
8 SASI_Hs01_00184518 predicted 960
9 SASI_Hs02_00362323 predicted 676
10 SASI_Hs01_00184519 predicted 926
11 SASI_Hs01_00184517 predicted 892
12 SASI_Hs01_00184520 predicted 732
13 SASI_Hs01_00184521 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254013 predicted 420
2 SASI_Rn02_00254014 predicted 358
3 SASI_Rn02_00254015 predicted 632
4 SASI_Rn02_00254016 predicted 545
5 SASI_Rn02_00254017 predicted 283
6 SASI_Rn02_00254018 predicted 481
7 SASI_Rn02_00254019 predicted 407
8 SASI_Rn02_00254020 predicted 463
9 SASI_Rn02_00254021 predicted 244
10 SASI_Rn02_00254022 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152274 predicted 342
2 SASI_Mm02_00332809 predicted 384
3 SASI_Mm01_00152275 predicted 308
4 SASI_Mm01_00152276 predicted 286
5 SASI_Mm01_00152277 predicted 613
6 SASI_Mm01_00152278 predicted 380
7 SASI_Mm01_00152280 predicted 314
8 SASI_Mm01_00152281 predicted 226
9 SASI_Mm01_00152282 predicted 661
10 SASI_Mm01_00152283 predicted 425
11 SASI_Mm01_00152279 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184896 predicted 528
2 SASI_Mm01_00184897 predicted 257
3 SASI_Mm01_00184898 predicted 288
4 SASI_Mm01_00184899 predicted 222
5 SASI_Mm01_00184900 predicted 200
6 SASI_Mm01_00184901 predicted 296
7 SASI_Mm01_00184902 predicted 350
8 SASI_Mm01_00184903 predicted 223
9 SASI_Mm01_00184904 predicted 576
10 SASI_Mm01_00184905 predicted 328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016085
VALIDATED
ATRAID MISSION shRNA Bacterial Glycerol Stock
all-trans retinoic acid-induced differentiation factor
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-644s1c1
Sequence:CCGGCCCAGAAATGTGTCCTGAGAACTCGAGTTCTCAGGACACATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-795s1c1
Sequence:CCGGCTATCCGTCTCCATTCTGCTTCTCGAGAAGCAGAATGGAGACGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-527s1c1
Sequence:CCGGGATACTGCCACAACATGTCAACTCGAGTTGACATGTTGTGGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-531s1c1
Sequence:CCGGCTGCCACAACATGTCAACTGTCTCGAGACAGTTGACATGTTGTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-748s1c1
Sequence:CCGGGCTCGTTCTCACTGCTTATGTCTCGAGACATAAGCAGTGAGAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-384s1c1
Sequence:CCGGCTGGATCTCCAGAACTGTTCTCTCGAGAGAACAGTTCTGGAGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-662s1c1
Sequence:CCGGGAATGGATCTTGTGTACCTGACTCGAGTCAGGTACACAAGATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-759s1c1
Sequence:CCGGCTGCTTATGTTCTTCGGGATTCTCGAGAATCCCGAAGAACATAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-979s21c1
Sequence:CCGGGAATGGATCTTGTGTACCTGACTCGAGTCAGGTACACAAGATCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-1112s21c1
Sequence:CCGGCTATCCGTCTCCATTCTGCTTCTCGAGAAGCAGAATGGAGACGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-1076s21c1
Sequence:CCGGCTGCTTATGTTCTTCGGGATTCTCGAGAATCCCGAAGAACATAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-1065s21c1
Sequence:CCGGGCTCGTTCTCACTGCTTATGTCTCGAGACATAAGCAGTGAGAACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016085
VALIDATED
ATRAID MISSION shRNA shRNA Plasmid DNA
all-trans retinoic acid-induced differentiation factor
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-644s1c1
Sequence:CCGGCCCAGAAATGTGTCCTGAGAACTCGAGTTCTCAGGACACATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-795s1c1
Sequence:CCGGCTATCCGTCTCCATTCTGCTTCTCGAGAAGCAGAATGGAGACGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-527s1c1
Sequence:CCGGGATACTGCCACAACATGTCAACTCGAGTTGACATGTTGTGGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-531s1c1
Sequence:CCGGCTGCCACAACATGTCAACTGTCTCGAGACAGTTGACATGTTGTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-748s1c1
Sequence:CCGGGCTCGTTCTCACTGCTTATGTCTCGAGACATAAGCAGTGAGAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-384s1c1
Sequence:CCGGCTGGATCTCCAGAACTGTTCTCTCGAGAGAACAGTTCTGGAGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-662s1c1
Sequence:CCGGGAATGGATCTTGTGTACCTGACTCGAGTCAGGTACACAAGATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-759s1c1
Sequence:CCGGCTGCTTATGTTCTTCGGGATTCTCGAGAATCCCGAAGAACATAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-979s21c1
Sequence:CCGGGAATGGATCTTGTGTACCTGACTCGAGTCAGGTACACAAGATCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-1112s21c1
Sequence:CCGGCTATCCGTCTCCATTCTGCTTCTCGAGAAGCAGAATGGAGACGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-1076s21c1
Sequence:CCGGCTGCTTATGTTCTTCGGGATTCTCGAGAATCCCGAAGAACATAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-1065s21c1
Sequence:CCGGGCTCGTTCTCACTGCTTATGTCTCGAGACATAAGCAGTGAGAACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016085
VALIDATED
ATRAID MISSION shRNA Lentiviral Transduction Particles
all-trans retinoic acid-induced differentiation factor
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-644s1c1
Sequence:CCGGCCCAGAAATGTGTCCTGAGAACTCGAGTTCTCAGGACACATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-795s1c1
Sequence:CCGGCTATCCGTCTCCATTCTGCTTCTCGAGAAGCAGAATGGAGACGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-527s1c1
Sequence:CCGGGATACTGCCACAACATGTCAACTCGAGTTGACATGTTGTGGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-531s1c1
Sequence:CCGGCTGCCACAACATGTCAACTGTCTCGAGACAGTTGACATGTTGTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-748s1c1
Sequence:CCGGGCTCGTTCTCACTGCTTATGTCTCGAGACATAAGCAGTGAGAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016085.2-384s1c1
Sequence:CCGGCTGGATCTCCAGAACTGTTCTCTCGAGAGAACAGTTCTGGAGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-662s1c1
Sequence:CCGGGAATGGATCTTGTGTACCTGACTCGAGTCAGGTACACAAGATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016085.2-759s1c1
Sequence:CCGGCTGCTTATGTTCTTCGGGATTCTCGAGAATCCCGAAGAACATAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-979s21c1
Sequence:CCGGGAATGGATCTTGTGTACCTGACTCGAGTCAGGTACACAAGATCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-1112s21c1
Sequence:CCGGCTATCCGTCTCCATTCTGCTTCTCGAGAAGCAGAATGGAGACGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-1076s21c1
Sequence:CCGGCTGCTTATGTTCTTCGGGATTCTCGAGAATCCCGAAGAACATAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016085.3-1065s21c1
Sequence:CCGGGCTCGTTCTCACTGCTTATGTCTCGAGACATAAGCAGTGAGAACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027855
VALIDATED
ATRAID MISSION shRNA Bacterial Glycerol Stock
all-trans retinoic acid-induced differentiation factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-744s1c1
Sequence:CCGGGCCAAGAAGATTTACTTCGTTCTCGAGAACGAAGTAAATCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-292s1c1
Sequence:CCGGGCAAATCCTCTCAAGGATGATCTCGAGATCATCCTTGAGAGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027855.2-527s1c1
Sequence:CCGGAGTGCGTTTGTGCTGATGGTTCTCGAGAACCATCAGCACAAACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-585s1c1
Sequence:CCGGACTGCTTATGTTCTTTGGGATCTCGAGATCCCAAAGAACATAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-471s1c1
Sequence:CCGGCCCAGAAATGTGTCCTGAGAACTCGAGTTCTCAGGACACATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-776s21c1
Sequence:CCGGGCCAATGAGCAGAACTGTTTACTCGAGTAAACAGTTCTGCTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-257s21c1
Sequence:CCGGTACAGGCTTATACTGCTATTACTCGAGTAATAGCAGTATAAGCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-104s21c1
Sequence:CCGGGTCCGGGAGGTATGCACAATTCTCGAGAATTGTGCATACCTCCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-585s21c1
Sequence:CCGGACTGCTTATGTTCTTTGGGATCTCGAGATCCCAAAGAACATAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-292s21c1
Sequence:CCGGGCAAATCCTCTCAAGGATGATCTCGAGATCATCCTTGAGAGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027855
VALIDATED
ATRAID MISSION shRNA shRNA Plasmid DNA
all-trans retinoic acid-induced differentiation factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-744s1c1
Sequence:CCGGGCCAAGAAGATTTACTTCGTTCTCGAGAACGAAGTAAATCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-292s1c1
Sequence:CCGGGCAAATCCTCTCAAGGATGATCTCGAGATCATCCTTGAGAGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027855.2-527s1c1
Sequence:CCGGAGTGCGTTTGTGCTGATGGTTCTCGAGAACCATCAGCACAAACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-585s1c1
Sequence:CCGGACTGCTTATGTTCTTTGGGATCTCGAGATCCCAAAGAACATAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-471s1c1
Sequence:CCGGCCCAGAAATGTGTCCTGAGAACTCGAGTTCTCAGGACACATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-776s21c1
Sequence:CCGGGCCAATGAGCAGAACTGTTTACTCGAGTAAACAGTTCTGCTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-257s21c1
Sequence:CCGGTACAGGCTTATACTGCTATTACTCGAGTAATAGCAGTATAAGCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-104s21c1
Sequence:CCGGGTCCGGGAGGTATGCACAATTCTCGAGAATTGTGCATACCTCCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-585s21c1
Sequence:CCGGACTGCTTATGTTCTTTGGGATCTCGAGATCCCAAAGAACATAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-292s21c1
Sequence:CCGGGCAAATCCTCTCAAGGATGATCTCGAGATCATCCTTGAGAGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027855
VALIDATED
ATRAID MISSION shRNA Lentiviral Transduction Particles
all-trans retinoic acid-induced differentiation factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-744s1c1
Sequence:CCGGGCCAAGAAGATTTACTTCGTTCTCGAGAACGAAGTAAATCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-292s1c1
Sequence:CCGGGCAAATCCTCTCAAGGATGATCTCGAGATCATCCTTGAGAGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027855.2-527s1c1
Sequence:CCGGAGTGCGTTTGTGCTGATGGTTCTCGAGAACCATCAGCACAAACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-585s1c1
Sequence:CCGGACTGCTTATGTTCTTTGGGATCTCGAGATCCCAAAGAACATAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027855.2-471s1c1
Sequence:CCGGCCCAGAAATGTGTCCTGAGAACTCGAGTTCTCAGGACACATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-776s21c1
Sequence:CCGGGCCAATGAGCAGAACTGTTTACTCGAGTAAACAGTTCTGCTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-257s21c1
Sequence:CCGGTACAGGCTTATACTGCTATTACTCGAGTAATAGCAGTATAAGCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-104s21c1
Sequence:CCGGGTCCGGGAGGTATGCACAATTCTCGAGAATTGTGCATACCTCCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-585s21c1
Sequence:CCGGACTGCTTATGTTCTTTGGGATCTCGAGATCCCAAAGAACATAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027855.2-292s21c1
Sequence:CCGGGCAAATCCTCTCAAGGATGATCTCGAGATCATCCTTGAGAGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks