EMAIL THIS PAGE TO A FRIEND

ATRIP

ATR interacting protein

88 Gene Product Result for
Gene ID:
Human(84126) Summary: This gene encodes an essential component of the DNA damage checkpoint. The encoded protein binds to single-stranded DNA coated with replication protein A. The protein also interacts with the ataxia telangiectasia and Rad3 related protein kinase, resulting in its accumulation at intranuclear foci induced by DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Mouse(235610) ATR interacting protein
Rat(301014) ATR interacting protein
Zebrafish(558534) ATR interacting protein
chicken(415949) ATR interacting protein
domestic cat(101088145) ATR interacting protein
Horse(100063799) ATR interacting protein
cow(100125287) ATR interacting protein
dog(608504) ATR interacting protein
naked mole-rat(101715729) ATR interacting protein
domestic guinea pig(100725412) ATR interacting protein
sheep(101110882) ATR interacting protein
Domestic Rabbit(100355293) ATR interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032166 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117081 MISSION® esiRNA esiRNA human TREX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032166 Rosetta Predictions human pricing
NM_130384 Rosetta Predictions human pricing
NM_001106859 Rosetta Predictions rat pricing
XM_217284 Rosetta Predictions rat pricing
NM_172774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359409 predicted 620
2 SASI_Hs02_00359410 predicted 1555
3 SASI_Hs02_00359411 predicted 1587
4 SASI_Hs02_00359412 predicted 467
5 SASI_Hs01_00070396 predicted 989
6 SASI_Hs02_00359413 predicted 578
7 SASI_Hs02_00359414 predicted 370
8 SASI_Hs02_00359415 predicted 1183
9 SASI_Hs02_00359416 predicted 383
10 SASI_Hs02_00359417 predicted 1637
11 SASI_Hs01_00070393 predicted 1176
12 SASI_Hs01_00070394 predicted 1089
13 SASI_Hs01_00070395 predicted 875
14 SASI_Hs01_00070397 predicted 987
15 SASI_Hs01_00070398 predicted 1006
16 SASI_Hs01_00070399 predicted 1082
17 SASI_Hs01_00070400 predicted 1162
18 SASI_Hs01_00070401 predicted 1080
19 SASI_Hs01_00070402 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362698 predicted 619
2 SASI_Hs02_00362699 predicted 1551
3 SASI_Hs02_00362700 predicted 1592
4 SASI_Hs02_00362701 predicted 467
5 SASI_Hs01_00061244 predicted 988
6 SASI_Hs02_00362702 predicted 584
7 SASI_Hs02_00362703 predicted 369
8 SASI_Hs02_00362704 predicted 1189
9 SASI_Hs02_00362705 predicted 380
10 SASI_Hs02_00362706 predicted 1634
11 SASI_Hs01_00061241 predicted 1168
12 SASI_Hs01_00061242 predicted 1081
13 SASI_Hs01_00061243 predicted 874
14 SASI_Hs01_00061245 predicted 993
15 SASI_Hs01_00061246 predicted 1000
16 SASI_Hs01_00061247 predicted 1082
17 SASI_Hs01_00061248 predicted 1164
18 SASI_Hs01_00061249 predicted 1071
19 SASI_Hs01_00061250 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223106 predicted 411
2 SASI_Rn02_00223107 predicted 1034
3 SASI_Rn02_00223108 predicted 369
4 SASI_Rn02_00223109 predicted 1156
5 SASI_Rn02_00223110 predicted 2284
6 SASI_Rn02_00223111 predicted 1810
7 SASI_Rn02_00223112 predicted 695
8 SASI_Rn02_00223113 predicted 728
9 SASI_Rn02_00223114 predicted 1251
10 SASI_Rn02_00223115 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159620 predicted 408
2 SASI_Rn01_00159621 predicted 1022
3 SASI_Rn01_00159622 predicted 669
4 SASI_Rn01_00159623 predicted 368
5 SASI_Rn01_00159624 predicted 1147
6 SASI_Rn01_00159625 predicted 2277
7 SASI_Rn01_00159626 predicted 1814
8 SASI_Rn01_00159627 predicted 688
9 SASI_Rn01_00159628 predicted 726
10 SASI_Rn01_00159629 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081160 predicted 405
2 SASI_Mm01_00081161 predicted 371
3 SASI_Mm01_00081163 predicted 670
4 SASI_Mm01_00081164 predicted 1157
5 SASI_Mm01_00081165 predicted 2008
6 SASI_Mm01_00081167 predicted 2064
7 SASI_Mm01_00081168 predicted 383
8 SASI_Mm01_00081169 predicted 1254
9 SASI_Mm02_00344667 predicted 359
10 SASI_Mm02_00344668 predicted 677
11 SASI_Mm01_00081162 predicted 596
12 SASI_Mm01_00081166 predicted 1625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032166
ATRIP MISSION shRNA Bacterial Glycerol Stock
ATR interacting protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-269s21c1
Sequence:CCGGGGACGTGTCCAGTGATCATAACTCGAGTTATGATCACTGGACACGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-878s21c1
Sequence:CCGGTCTGAGAGGTGACTCCATAAACTCGAGTTTATGGAGTCACCTCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-1501s21c1
Sequence:CCGGGAGCAGTCGTCTCCCTATTACCTCGAGGTAATAGGGAGACGACTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-849s21c1
Sequence:CCGGGTGGGCAGAGAGGATAGTAAGCTCGAGCTTACTATCCTCTCTGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-653s21c1
Sequence:CCGGGACCAGTGAACGAGCAAATAACTCGAGTTATTTGCTCGTTCACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032166
ATRIP MISSION shRNA shRNA Plasmid DNA
ATR interacting protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-269s21c1
Sequence:CCGGGGACGTGTCCAGTGATCATAACTCGAGTTATGATCACTGGACACGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-878s21c1
Sequence:CCGGTCTGAGAGGTGACTCCATAAACTCGAGTTTATGGAGTCACCTCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-1501s21c1
Sequence:CCGGGAGCAGTCGTCTCCCTATTACCTCGAGGTAATAGGGAGACGACTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-849s21c1
Sequence:CCGGGTGGGCAGAGAGGATAGTAAGCTCGAGCTTACTATCCTCTCTGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-653s21c1
Sequence:CCGGGACCAGTGAACGAGCAAATAACTCGAGTTATTTGCTCGTTCACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032166
ATRIP MISSION shRNA Lentiviral Transduction Particles
ATR interacting protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-269s21c1
Sequence:CCGGGGACGTGTCCAGTGATCATAACTCGAGTTATGATCACTGGACACGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-878s21c1
Sequence:CCGGTCTGAGAGGTGACTCCATAAACTCGAGTTTATGGAGTCACCTCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-1501s21c1
Sequence:CCGGGAGCAGTCGTCTCCCTATTACCTCGAGGTAATAGGGAGACGACTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-849s21c1
Sequence:CCGGGTGGGCAGAGAGGATAGTAAGCTCGAGCTTACTATCCTCTCTGCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032166.2-653s21c1
Sequence:CCGGGACCAGTGAACGAGCAAATAACTCGAGTTATTTGCTCGTTCACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172774
ATRIP MISSION shRNA Bacterial Glycerol Stock
ATR interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-1704s1c1
Sequence:CCGGCCACTGCTAAAGATGCTTCTTCTCGAGAAGAAGCATCTTTAGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-378s1c1
Sequence:CCGGCGATTAGATGGGTTACCAAATCTCGAGATTTGGTAACCCATCTAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-558s1c1
Sequence:CCGGCGTCAGACAGAATCCGTTCTACTCGAGTAGAACGGATTCTGTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-415s1c1
Sequence:CCGGGCAGAGAAGATATTCCAGTTACTCGAGTAACTGGAATATCTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-376s1c1
Sequence:CCGGGCCGATTAGATGGGTTACCAACTCGAGTTGGTAACCCATCTAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172774
ATRIP MISSION shRNA shRNA Plasmid DNA
ATR interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-1704s1c1
Sequence:CCGGCCACTGCTAAAGATGCTTCTTCTCGAGAAGAAGCATCTTTAGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-378s1c1
Sequence:CCGGCGATTAGATGGGTTACCAAATCTCGAGATTTGGTAACCCATCTAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-558s1c1
Sequence:CCGGCGTCAGACAGAATCCGTTCTACTCGAGTAGAACGGATTCTGTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-415s1c1
Sequence:CCGGGCAGAGAAGATATTCCAGTTACTCGAGTAACTGGAATATCTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-376s1c1
Sequence:CCGGGCCGATTAGATGGGTTACCAACTCGAGTTGGTAACCCATCTAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172774
ATRIP MISSION shRNA Lentiviral Transduction Particles
ATR interacting protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-1704s1c1
Sequence:CCGGCCACTGCTAAAGATGCTTCTTCTCGAGAAGAAGCATCTTTAGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-378s1c1
Sequence:CCGGCGATTAGATGGGTTACCAAATCTCGAGATTTGGTAACCCATCTAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-558s1c1
Sequence:CCGGCGTCAGACAGAATCCGTTCTACTCGAGTAGAACGGATTCTGTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-415s1c1
Sequence:CCGGGCAGAGAAGATATTCCAGTTACTCGAGTAACTGGAATATCTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172774.1-376s1c1
Sequence:CCGGGCCGATTAGATGGGTTACCAACTCGAGTTGGTAACCCATCTAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)