EMAIL THIS PAGE TO A FRIEND

ATRN

attractin

175 Gene Product Result for
Synonyms: DPPT-L MGCA
Gene ID:
Human(8455) Summary: Multiple transcript variants encoding different isoforms exist for this gene. One of the isoforms is a membrane-bound protein with sequence similarity to the mouse mahogany protein, a receptor involved in controlling obesity. The other two isoforms are secreted proteins involved in the initial immune cell clustering during inflammatory responses that may regulate the chemotactic activity of chemokines. [provided by RefSeq, May 2011]
Mouse(11990) attractin
Rat(83526) attractin
sheep(100188914) attractin
Zebrafish(792417) attractin
cow(281017) attractin
dog(477170) attractin
chicken(422946) attractin
Zebrafish(794975) attractin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0469 AQUA Peptide YQGNPL[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012070 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139322 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139321 Rosetta Predictions human pricing
NM_139322 Rosetta Predictions human pricing
NM_031351 Rosetta Predictions rat pricing
NM_009730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242780 predicted 1235
2 SASI_Hs02_00364294 predicted 1495
3 SASI_Hs01_00242781 predicted 2506
4 SASI_Hs01_00242782 predicted 1131
5 SASI_Hs01_00242783 predicted 2578
6 SASI_Hs01_00242784 predicted 1160
7 SASI_Hs02_00364295 predicted 3259
8 SASI_Hs02_00364296 predicted 1996
9 SASI_Hs01_00242786 predicted 3129
10 SASI_Hs01_00242788 predicted 676
11 SASI_Hs01_00242785 predicted 3230
12 SASI_Hs01_00242787 predicted 2591
13 SASI_Hs01_00242789 predicted 1491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047680 predicted 1238
2 SASI_Hs02_00364297 predicted 1499
3 SASI_Hs01_00047681 predicted 2510
4 SASI_Hs01_00047682 predicted 1131
5 SASI_Hs01_00047683 predicted 2578
6 SASI_Hs01_00047684 predicted 1169
7 SASI_Hs02_00364298 predicted 3261
8 SASI_Hs02_00364299 predicted 2001
9 SASI_Hs01_00047686 predicted 3130
10 SASI_Hs01_00047688 predicted 677
11 SASI_Hs01_00047685 predicted 3226
12 SASI_Hs01_00047687 predicted 2593
13 SASI_Hs01_00047689 predicted 1486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079842 predicted 810
2 SASI_Rn02_00264597 predicted 3219
3 SASI_Rn01_00079843 predicted 3349
4 SASI_Rn01_00079844 predicted 3751
5 SASI_Rn01_00079845 predicted 1461
6 SASI_Rn01_00079846 predicted 1825
7 SASI_Rn01_00079848 predicted 1685
8 SASI_Rn01_00079849 predicted 1902
9 SASI_Rn01_00079850 predicted 662
10 SASI_Rn02_00264598 predicted 2645
11 SASI_Rn01_00079841 predicted 2674
12 SASI_Rn01_00079847 predicted 1651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137214 predicted 2487
2 SASI_Mm01_00137216 predicted 1900
3 SASI_Mm02_00316892 predicted 1880
4 SASI_Mm01_00137217 predicted 3343
5 SASI_Mm01_00137218 predicted 1015
6 SASI_Mm01_00137219 predicted 801
7 SASI_Mm01_00137220 predicted 1677
8 SASI_Mm01_00137222 predicted 3100
9 SASI_Mm01_00137223 predicted 2469
10 SASI_Mm02_00316893 predicted 1554
11 SASI_Mm01_00137215 predicted 2325
12 SASI_Mm01_00137221 predicted 1828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009730
VALIDATED
ATRN MISSION shRNA Bacterial Glycerol Stock
attractin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009730.1-4992s1c1
Sequence:CCGGGCCTCACAAATGCTGGGATAACTCGAGTTATCCCAGCATTTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-956s1c1
Sequence:CCGGGCATCTGTAATGCAAGCGATACTCGAGTATCGCTTGCATTACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-1102s1c1
Sequence:CCGGGCTGTGGTCAATGGAAATATACTCGAGTATATTTCCATTGACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-3476s1c1
Sequence:CCGGGCCAGCTATGTGAGGTAGAAACTCGAGTTTCTACCTCACATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-1372s1c1
Sequence:CCGGCCGAAAGCTAAGGATCAGTATCTCGAGATACTGATCCTTAGCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009730
VALIDATED
ATRN MISSION shRNA shRNA Plasmid DNA
attractin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009730.1-4992s1c1
Sequence:CCGGGCCTCACAAATGCTGGGATAACTCGAGTTATCCCAGCATTTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-956s1c1
Sequence:CCGGGCATCTGTAATGCAAGCGATACTCGAGTATCGCTTGCATTACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-1102s1c1
Sequence:CCGGGCTGTGGTCAATGGAAATATACTCGAGTATATTTCCATTGACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-3476s1c1
Sequence:CCGGGCCAGCTATGTGAGGTAGAAACTCGAGTTTCTACCTCACATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-1372s1c1
Sequence:CCGGCCGAAAGCTAAGGATCAGTATCTCGAGATACTGATCCTTAGCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009730
VALIDATED
ATRN MISSION shRNA Lentiviral Transduction Particles
attractin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009730.1-4992s1c1
Sequence:CCGGGCCTCACAAATGCTGGGATAACTCGAGTTATCCCAGCATTTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-956s1c1
Sequence:CCGGGCATCTGTAATGCAAGCGATACTCGAGTATCGCTTGCATTACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-1102s1c1
Sequence:CCGGGCTGTGGTCAATGGAAATATACTCGAGTATATTTCCATTGACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-3476s1c1
Sequence:CCGGGCCAGCTATGTGAGGTAGAAACTCGAGTTTCTACCTCACATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009730.1-1372s1c1
Sequence:CCGGCCGAAAGCTAAGGATCAGTATCTCGAGATACTGATCCTTAGCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012070
VALIDATED
ATRN MISSION shRNA Bacterial Glycerol Stock
attractin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-3366s1c1
Sequence:CCGGCCCAGGAAGATGATCGCTATTCTCGAGAATAGCGATCATCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-2270s1c1
Sequence:CCGGGCCAAGGAGAATTATGACAATCTCGAGATTGTCATAATTCTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-1260s1c1
Sequence:CCGGGCCCTCTCTATGGATATATAACTCGAGTTATATATCCATAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-3598s1c1
Sequence:CCGGCCACCCAAATATCACTTTCTTCTCGAGAAGAAAGTGATATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012070.2-654s1c1
Sequence:CCGGGCGATACTGTTGAATGTGAATCTCGAGATTCACATTCAACAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012070
VALIDATED
ATRN MISSION shRNA shRNA Plasmid DNA
attractin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-3366s1c1
Sequence:CCGGCCCAGGAAGATGATCGCTATTCTCGAGAATAGCGATCATCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-2270s1c1
Sequence:CCGGGCCAAGGAGAATTATGACAATCTCGAGATTGTCATAATTCTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-1260s1c1
Sequence:CCGGGCCCTCTCTATGGATATATAACTCGAGTTATATATCCATAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-3598s1c1
Sequence:CCGGCCACCCAAATATCACTTTCTTCTCGAGAAGAAAGTGATATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012070.2-654s1c1
Sequence:CCGGGCGATACTGTTGAATGTGAATCTCGAGATTCACATTCAACAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012070
VALIDATED
ATRN MISSION shRNA Lentiviral Transduction Particles
attractin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-3366s1c1
Sequence:CCGGCCCAGGAAGATGATCGCTATTCTCGAGAATAGCGATCATCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-2270s1c1
Sequence:CCGGGCCAAGGAGAATTATGACAATCTCGAGATTGTCATAATTCTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-1260s1c1
Sequence:CCGGGCCCTCTCTATGGATATATAACTCGAGTTATATATCCATAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012070.2-3598s1c1
Sequence:CCGGCCACCCAAATATCACTTTCTTCTCGAGAAGAAAGTGATATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012070.2-654s1c1
Sequence:CCGGGCGATACTGTTGAATGTGAATCTCGAGATTCACATTCAACAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139322
ATRN MISSION shRNA Bacterial Glycerol Stock
attractin
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000291358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-3599s21c1
Sequence:CCGGCCCAGGAAGATGATCGCTATTCTCGAGAATAGCGATCATCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-887s21c1
Sequence:CCGGGCGATACTGTTGAATGTGAATCTCGAGATTCACATTCAACAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-2503s21c1
Sequence:CCGGGCCAAGGAGAATTATGACAATCTCGAGATTGTCATAATTCTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-1493s21c1
Sequence:CCGGGCCCTCTCTATGGATATATAACTCGAGTTATATATCCATAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139322
ATRN MISSION shRNA shRNA Plasmid DNA
attractin
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000291358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-3599s21c1
Sequence:CCGGCCCAGGAAGATGATCGCTATTCTCGAGAATAGCGATCATCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-887s21c1
Sequence:CCGGGCGATACTGTTGAATGTGAATCTCGAGATTCACATTCAACAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-2503s21c1
Sequence:CCGGGCCAAGGAGAATTATGACAATCTCGAGATTGTCATAATTCTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-1493s21c1
Sequence:CCGGGCCCTCTCTATGGATATATAACTCGAGTTATATATCCATAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139322
ATRN MISSION shRNA Lentiviral Transduction Particles
attractin
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000291358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-3599s21c1
Sequence:CCGGCCCAGGAAGATGATCGCTATTCTCGAGAATAGCGATCATCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-887s21c1
Sequence:CCGGGCGATACTGTTGAATGTGAATCTCGAGATTCACATTCAACAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-2503s21c1
Sequence:CCGGGCCAAGGAGAATTATGACAATCTCGAGATTGTCATAATTCTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139322.2-1493s21c1
Sequence:CCGGGCCCTCTCTATGGATATATAACTCGAGTTATATATCCATAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks