EMAIL THIS PAGE TO A FRIEND

ATRNL1

attractin-like 1

Synonyms: ALP bA338L11.1 bA454H24.1
Gene ID:
Mouse(226255) attractin like 1
Rat(307992) attractin like 1
chicken(423915) attractin-like 1
dog(486901) attractin-like 1
domestic cat(101084994) attractin-like 1
cow(504617) attractin-like 1
Horse(100058912) attractin-like 1
naked mole-rat(101701189) attractin-like 1
sheep(101119865) attractin-like 1
Domestic Rabbit(100348772) attractin-like 1
218 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038070 Anti-ATRNL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207303 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071171 MISSION® esiRNA esiRNA human ATRNL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207303 Rosetta Predictions human pricing
XM_001064577 Rosetta Predictions rat pricing
XM_217657 Rosetta Predictions rat pricing
NM_181415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110128 predicted 3679
2 SASI_Hs01_00110129 predicted 2662
3 SASI_Hs01_00110130 predicted 2798
4 SASI_Hs01_00110131 predicted 2148
5 SASI_Hs01_00110132 predicted 1904
6 SASI_Hs01_00110133 predicted 3388
7 SASI_Hs01_00110134 predicted 1694
8 SASI_Hs01_00110135 predicted 2554
9 SASI_Hs01_00110137 predicted 1248
10 SASI_Hs02_00373828 predicted 4264
11 SASI_Hs01_00110136 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311023 predicted 4415
2 SASI_Rn02_00311024 predicted 2234
3 SASI_Rn02_00311025 predicted 1554
4 SASI_Rn02_00311026 predicted 943
5 SASI_Rn02_00311027 predicted 1804
6 SASI_Rn02_00311028 predicted 3909
7 SASI_Rn02_00311029 predicted 1894
8 SASI_Rn02_00311030 predicted 4428
9 SASI_Rn02_00311031 predicted 1089
10 SASI_Rn02_00311032 predicted 3972
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377295 predicted 4491
2 SASI_Rn02_00377296 predicted 2345
3 SASI_Rn02_00377297 predicted 1663
4 SASI_Rn02_00377298 predicted 1049
5 SASI_Rn02_00377299 predicted 1913
6 SASI_Rn02_00377300 predicted 3986
7 SASI_Rn02_00377301 predicted 1998
8 SASI_Rn02_00377302 predicted 4504
9 SASI_Rn02_00377303 predicted 1191
10 SASI_Rn02_00377304 predicted 4047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050769 predicted 1476
2 SASI_Mm01_00050770 predicted 1666
3 SASI_Mm02_00349773 predicted 1643
4 SASI_Mm01_00050771 predicted 1620
5 SASI_Mm01_00050772 predicted 742
6 SASI_Mm02_00349774 predicted 3586
7 SASI_Mm01_00050773 predicted 2099
8 SASI_Mm01_00050774 predicted 3981
9 SASI_Mm01_00050775 predicted 1708
10 SASI_Mm01_00050776 predicted 2581
11 SASI_Mm01_00050777 predicted 1301
12 SASI_Mm01_00050778 predicted 3694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207303
ATRNL1 MISSION shRNA Bacterial Glycerol Stock
attractin-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207303.2-1830s21c1
Sequence:CCGGTATGTTCATGGAGGGTATAAACTCGAGTTTATACCCTCCATGAACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207303.2-708s21c1
Sequence:CCGGGATGGCCCAATTAACTATAAACTCGAGTTTATAGTTAATTGGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207303.2-3510s21c1
Sequence:CCGGGATTGTATGCCAGGTTATTATCTCGAGATAATAACCTGGCATACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-3649s1c1
Sequence:CCGGGCCAATTATGTGACTCTGAAACTCGAGTTTCAGAGTCACATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-4422s1c1
Sequence:CCGGGCCCTAATAGATATTTCACAACTCGAGTTGTGAAATATCTATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-1856s1c1
Sequence:CCGGGCCAGGGAACAAATATGGATTCTCGAGAATCCATATTTGTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-2418s1c1
Sequence:CCGGGCCAATACAAATGGGTGCCAACTCGAGTTGGCACCCATTTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-855s1c1
Sequence:CCGGGCACCTTTAATAGCTGTACTTCTCGAGAAGTACAGCTATTAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207303
ATRNL1 MISSION shRNA shRNA Plasmid DNA
attractin-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207303.2-1830s21c1
Sequence:CCGGTATGTTCATGGAGGGTATAAACTCGAGTTTATACCCTCCATGAACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207303.2-708s21c1
Sequence:CCGGGATGGCCCAATTAACTATAAACTCGAGTTTATAGTTAATTGGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207303.2-3510s21c1
Sequence:CCGGGATTGTATGCCAGGTTATTATCTCGAGATAATAACCTGGCATACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-3649s1c1
Sequence:CCGGGCCAATTATGTGACTCTGAAACTCGAGTTTCAGAGTCACATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-4422s1c1
Sequence:CCGGGCCCTAATAGATATTTCACAACTCGAGTTGTGAAATATCTATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-1856s1c1
Sequence:CCGGGCCAGGGAACAAATATGGATTCTCGAGAATCCATATTTGTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-2418s1c1
Sequence:CCGGGCCAATACAAATGGGTGCCAACTCGAGTTGGCACCCATTTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-855s1c1
Sequence:CCGGGCACCTTTAATAGCTGTACTTCTCGAGAAGTACAGCTATTAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207303
ATRNL1 MISSION shRNA Lentiviral Transduction Particles
attractin-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207303.2-1830s21c1
Sequence:CCGGTATGTTCATGGAGGGTATAAACTCGAGTTTATACCCTCCATGAACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207303.2-708s21c1
Sequence:CCGGGATGGCCCAATTAACTATAAACTCGAGTTTATAGTTAATTGGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207303.2-3510s21c1
Sequence:CCGGGATTGTATGCCAGGTTATTATCTCGAGATAATAACCTGGCATACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-3649s1c1
Sequence:CCGGGCCAATTATGTGACTCTGAAACTCGAGTTTCAGAGTCACATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-4422s1c1
Sequence:CCGGGCCCTAATAGATATTTCACAACTCGAGTTGTGAAATATCTATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-1856s1c1
Sequence:CCGGGCCAGGGAACAAATATGGATTCTCGAGAATCCATATTTGTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-2418s1c1
Sequence:CCGGGCCAATACAAATGGGTGCCAACTCGAGTTGGCACCCATTTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207303.1-855s1c1
Sequence:CCGGGCACCTTTAATAGCTGTACTTCTCGAGAAGTACAGCTATTAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181415
ATRNL1 MISSION shRNA Bacterial Glycerol Stock
attractin-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181415.3-6037s1c1
Sequence:CCGGGCATGATAGTTCTACTCTATTCTCGAGAATAGAGTAGAACTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-2609s1c1
Sequence:CCGGGCTATGATAATGCCAAACTTTCTCGAGAAAGTTTGGCATTATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-1806s1c1
Sequence:CCGGCCTCTATAAGTACGAAGTCAACTCGAGTTGACTTCGTACTTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-4368s1c1
Sequence:CCGGGCCTTCTGATAATAAAGACAACTCGAGTTGTCTTTATTATCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-1451s1c1
Sequence:CCGGCCGATGAATTATGGGTGTTTACTCGAGTAAACACCCATAATTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181415
ATRNL1 MISSION shRNA shRNA Plasmid DNA
attractin-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181415.3-6037s1c1
Sequence:CCGGGCATGATAGTTCTACTCTATTCTCGAGAATAGAGTAGAACTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-2609s1c1
Sequence:CCGGGCTATGATAATGCCAAACTTTCTCGAGAAAGTTTGGCATTATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-1806s1c1
Sequence:CCGGCCTCTATAAGTACGAAGTCAACTCGAGTTGACTTCGTACTTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-4368s1c1
Sequence:CCGGGCCTTCTGATAATAAAGACAACTCGAGTTGTCTTTATTATCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-1451s1c1
Sequence:CCGGCCGATGAATTATGGGTGTTTACTCGAGTAAACACCCATAATTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181415
ATRNL1 MISSION shRNA Lentiviral Transduction Particles
attractin-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181415.3-6037s1c1
Sequence:CCGGGCATGATAGTTCTACTCTATTCTCGAGAATAGAGTAGAACTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-2609s1c1
Sequence:CCGGGCTATGATAATGCCAAACTTTCTCGAGAAAGTTTGGCATTATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-1806s1c1
Sequence:CCGGCCTCTATAAGTACGAAGTCAACTCGAGTTGACTTCGTACTTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-4368s1c1
Sequence:CCGGGCCTTCTGATAATAAAGACAACTCGAGTTGTCTTTATTATCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181415.3-1451s1c1
Sequence:CCGGCCGATGAATTATGGGTGTTTACTCGAGTAAACACCCATAATTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks