EMAIL THIS PAGE TO A FRIEND

ATRX

alpha thalassemia/mental retardation syndrome X-linked

243 Gene Product Result for
Synonyms: ATR2 JMS MRXHF1 RAD54 RAD54L SFM1 SHS XH2 XNP ZNF-HX
Gene ID:
Human(546) Summary: The protein encoded by this gene contains an ATPase/helicase domain, and thus it belongs to the SWI/SNF family of chromatin remodeling proteins. The mutations of this gene are associated with an X-linked mental retardation (XLMR) syndrome most often accompanied by alpha-thalassemia (ATRX) syndrome. These mutations have been shown to cause diverse changes in the pattern of DNA methylation, which may provide a link between chromatin remodeling, DNA methylation, and gene expression in developmental processes. This protein is found to undergo cell cycle-dependent phosphorylation, which regulates its nuclear matrix and chromatin association, and suggests its involvement in the gene regulation at interphase and chromosomal segregation in mitosis. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(22589) alpha thalassemia/mental retardation syndrome X-linked homolog (human)
Rat(246284) alpha thalassemia/mental retardation syndrome X-linked
Zebrafish(323299) alpha thalassemia/mental retardation syndrome X-linked homolog (human)
Thale Cress(837382) ATRX, DEXDc and helicase domain-containing protein
domestic cat(101086543) alpha thalassemia/mental retardation syndrome X-linked
cow(514473) alpha thalassemia/mental retardation syndrome X-linked
dog(480963) alpha thalassemia/mental retardation syndrome X-linked
chicken(422331) alpha thalassemia/mental retardation syndrome X-linked
sheep(101117394) alpha thalassemia/mental retardation syndrome X-linked
Domestic Rabbit(100358645) alpha thalassemia/mental retardation syndrome X-linked
domestic guinea pig(100715238) alpha thalassemia/mental retardation syndrome X-linked
naked mole-rat(101705766) alpha thalassemia/mental retardation syndrome X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000489 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000489 Rosetta Predictions human pricing
NM_138270 Rosetta Predictions human pricing
NM_138271 Rosetta Predictions human pricing
NM_001105757 Rosetta Predictions rat pricing
NM_009530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081479 predicted 5431
2 SASI_Hs01_00081480 predicted 6465
3 SASI_Hs02_00302642 predicted 5591
4 SASI_Hs02_00302643 predicted 3677
5 SASI_Hs01_00081481 predicted 6764
6 SASI_Hs01_00081484 predicted 5491
7 SASI_Hs01_00081485 predicted 1250
8 SASI_Hs01_00081487 predicted 2232
9 SASI_Hs02_00302644 predicted 5252
10 SASI_Hs02_00302645 predicted 7398
11 SASI_Hs01_00081482 predicted 5020
12 SASI_Hs01_00081483 predicted 7249
13 SASI_Hs01_00081486 predicted 4919
14 SASI_Hs01_00081488 predicted 7319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219392 predicted 5309
2 SASI_Hs01_00219393 predicted 6352
3 SASI_Hs02_00363337 predicted 5482
4 SASI_Hs02_00363338 predicted 3559
5 SASI_Hs01_00219394 predicted 6653
6 SASI_Hs01_00219397 predicted 5371
7 SASI_Hs01_00219398 predicted 1133
8 SASI_Hs01_00219400 predicted 2117
9 SASI_Hs02_00363339 predicted 5144
10 SASI_Hs02_00363340 predicted 7280
11 SASI_Hs01_00219395 predicted 4901
12 SASI_Hs01_00219396 predicted 7141
13 SASI_Hs01_00219399 predicted 4802
14 SASI_Hs01_00219401 predicted 7203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119785 predicted 5539
2 SASI_Hs01_00119786 predicted 2616
3 SASI_Hs01_00119787 predicted 6580
4 SASI_Hs01_00119788 predicted 6876
5 SASI_Hs01_00119789 predicted 5135
6 SASI_Hs01_00119790 predicted 7369
7 SASI_Hs01_00119791 predicted 5601
8 SASI_Hs01_00119792 predicted 1359
9 SASI_Hs01_00119793 predicted 5047
10 SASI_Hs01_00119794 predicted 2346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212226 predicted 5547
2 SASI_Rn02_00212227 predicted 6182
3 SASI_Rn02_00212228 predicted 5439
4 SASI_Rn02_00212229 predicted 6482
5 SASI_Rn02_00212230 predicted 6528
6 SASI_Rn02_00212231 predicted 5256
7 SASI_Rn02_00212232 predicted 5030
8 SASI_Rn02_00212233 predicted 5530
9 SASI_Rn02_00212234 predicted 6111
10 SASI_Rn02_00212235 predicted 7017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198983 predicted 1634
2 SASI_Mm01_00198984 predicted 5961
3 SASI_Mm01_00198985 predicted 1197
4 SASI_Mm01_00198987 predicted 7403
5 SASI_Mm01_00198988 predicted 4846
6 SASI_Mm01_00198989 predicted 6546
7 SASI_Mm02_00316333 predicted 1769
8 SASI_Mm02_00316334 predicted 1398
9 SASI_Mm01_00198992 predicted 1695
10 SASI_Mm02_00316335 predicted 1405
11 SASI_Mm01_00198986 predicted 2310
12 SASI_Mm01_00198990 predicted 7337
13 SASI_Mm01_00198991 predicted 1388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000489
VALIDATED
ATRX MISSION shRNA Bacterial Glycerol Stock
alpha thalassemia/mental retardation syndrome X-linked
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000489.2-9931s1c1
Sequence:CCGGGCCTGCTAAATTCTCCACATTCTCGAGAATGTGGAGAATTTAGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000489.2-2215s1c1
Sequence:CCGGCGACAGAAACTAACCCTGTAACTCGAGTTACAGGGTTAGTTTCTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000489.2-4491s1c1
Sequence:CCGGCGACGTATTAAGGTTCAAGAACTCGAGTTCTTGAACCTTAATACGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000489.2-1681s1c1
Sequence:CCGGCCGGTGGTGAACATAAGAAATCTCGAGATTTCTTATGTTCACCACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000489.2-7571s1c1
Sequence:CCGGGCAGATTGATATGAGAGGAATCTCGAGATTCCTCTCATATCAATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000489.3-5447s21c1
Sequence:CCGGCGATCAAGGAGGAGGATTATTCTCGAGAATAATCCTCCTCCTTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000489.3-6464s21c1
Sequence:CCGGCTTCGAAACATTGACTATTACCTCGAGGTAATAGTCAATGTTTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000489.3-8125s21c1
Sequence:CCGGGAGTTGATTCCTCAAGTTATGCTCGAGCATAACTTGAGGAATCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000489.3-7273s21c1
Sequence:CCGGTCAACCTCTTGAGGATATAATCTCGAGATTATATCCTCAAGAGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000489.3-2357s21c1
Sequence:CCGGGATAATCCTAAGCCTAATAAACTCGAGTTTATTAGGCTTAGGATTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000489
VALIDATED
ATRX MISSION shRNA shRNA Plasmid DNA
alpha thalassemia/mental retardation syndrome X-linked
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000489.2-9931s1c1
Sequence:CCGGGCCTGCTAAATTCTCCACATTCTCGAGAATGTGGAGAATTTAGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000489.2-2215s1c1
Sequence:CCGGCGACAGAAACTAACCCTGTAACTCGAGTTACAGGGTTAGTTTCTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000489.2-4491s1c1
Sequence:CCGGCGACGTATTAAGGTTCAAGAACTCGAGTTCTTGAACCTTAATACGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000489.2-1681s1c1
Sequence:CCGGCCGGTGGTGAACATAAGAAATCTCGAGATTTCTTATGTTCACCACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000489.2-7571s1c1
Sequence:CCGGGCAGATTGATATGAGAGGAATCTCGAGATTCCTCTCATATCAATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000489.3-5447s21c1
Sequence:CCGGCGATCAAGGAGGAGGATTATTCTCGAGAATAATCCTCCTCCTTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000489.3-6464s21c1
Sequence:CCGGCTTCGAAACATTGACTATTACCTCGAGGTAATAGTCAATGTTTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000489.3-8125s21c1
Sequence:CCGGGAGTTGATTCCTCAAGTTATGCTCGAGCATAACTTGAGGAATCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000489.3-7273s21c1
Sequence:CCGGTCAACCTCTTGAGGATATAATCTCGAGATTATATCCTCAAGAGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000489.3-2357s21c1
Sequence:CCGGGATAATCCTAAGCCTAATAAACTCGAGTTTATTAGGCTTAGGATTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000489
VALIDATED
ATRX MISSION shRNA Lentiviral Transduction Particles
alpha thalassemia/mental retardation syndrome X-linked
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000489.2-9931s1c1
Sequence:CCGGGCCTGCTAAATTCTCCACATTCTCGAGAATGTGGAGAATTTAGCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000489.2-2215s1c1
Sequence:CCGGCGACAGAAACTAACCCTGTAACTCGAGTTACAGGGTTAGTTTCTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000489.2-4491s1c1
Sequence:CCGGCGACGTATTAAGGTTCAAGAACTCGAGTTCTTGAACCTTAATACGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000489.2-1681s1c1
Sequence:CCGGCCGGTGGTGAACATAAGAAATCTCGAGATTTCTTATGTTCACCACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000489.2-7571s1c1
Sequence:CCGGGCAGATTGATATGAGAGGAATCTCGAGATTCCTCTCATATCAATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000489.3-5447s21c1
Sequence:CCGGCGATCAAGGAGGAGGATTATTCTCGAGAATAATCCTCCTCCTTGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000489.3-6464s21c1
Sequence:CCGGCTTCGAAACATTGACTATTACCTCGAGGTAATAGTCAATGTTTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000489.3-8125s21c1
Sequence:CCGGGAGTTGATTCCTCAAGTTATGCTCGAGCATAACTTGAGGAATCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000489.3-7273s21c1
Sequence:CCGGTCAACCTCTTGAGGATATAATCTCGAGATTATATCCTCAAGAGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000489.3-2357s21c1
Sequence:CCGGGATAATCCTAAGCCTAATAAACTCGAGTTTATTAGGCTTAGGATTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009530
VALIDATED
ATRX MISSION shRNA Bacterial Glycerol Stock
alpha thalassemia/mental retardation syndrome X-linked
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009530.1-7511s1c1
Sequence:CCGGCCTTCTAACTACCAGCAGATTCTCGAGAATCTGCTGGTAGTTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009530.1-509s1c1
Sequence:CCGGCCCACGGATGAGAATGTAAATCTCGAGATTTACATTCTCATCCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009530.1-1713s1c1
Sequence:CCGGCCACTAACACTCCTGAGGATTCTCGAGAATCCTCAGGAGTGTTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009530.1-7064s1c1
Sequence:CCGGCCTGTCACTTTCACCTCTCAACTCGAGTTGAGAGGTGAAAGTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-542s21c1
Sequence:CCGGCCCACGGATGAGAATGTAAATCTCGAGATTTACATTCTCATCCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-7544s21c1
Sequence:CCGGCCTTCTAACTACCAGCAGATTCTCGAGAATCTGCTGGTAGTTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-1746s21c1
Sequence:CCGGCCACTAACACTCCTGAGGATTCTCGAGAATCCTCAGGAGTGTTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-1412s21c1
Sequence:CCGGGCTATGAAGTTATGTCAACTTCTCGAGAAGTTGACATAACTTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009530
VALIDATED
ATRX MISSION shRNA shRNA Plasmid DNA
alpha thalassemia/mental retardation syndrome X-linked
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009530.1-7511s1c1
Sequence:CCGGCCTTCTAACTACCAGCAGATTCTCGAGAATCTGCTGGTAGTTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009530.1-509s1c1
Sequence:CCGGCCCACGGATGAGAATGTAAATCTCGAGATTTACATTCTCATCCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009530.1-1713s1c1
Sequence:CCGGCCACTAACACTCCTGAGGATTCTCGAGAATCCTCAGGAGTGTTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009530.1-7064s1c1
Sequence:CCGGCCTGTCACTTTCACCTCTCAACTCGAGTTGAGAGGTGAAAGTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-542s21c1
Sequence:CCGGCCCACGGATGAGAATGTAAATCTCGAGATTTACATTCTCATCCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-7544s21c1
Sequence:CCGGCCTTCTAACTACCAGCAGATTCTCGAGAATCTGCTGGTAGTTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-1746s21c1
Sequence:CCGGCCACTAACACTCCTGAGGATTCTCGAGAATCCTCAGGAGTGTTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-1412s21c1
Sequence:CCGGGCTATGAAGTTATGTCAACTTCTCGAGAAGTTGACATAACTTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009530
VALIDATED
ATRX MISSION shRNA Lentiviral Transduction Particles
alpha thalassemia/mental retardation syndrome X-linked
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009530.1-7511s1c1
Sequence:CCGGCCTTCTAACTACCAGCAGATTCTCGAGAATCTGCTGGTAGTTAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009530.1-509s1c1
Sequence:CCGGCCCACGGATGAGAATGTAAATCTCGAGATTTACATTCTCATCCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009530.1-1713s1c1
Sequence:CCGGCCACTAACACTCCTGAGGATTCTCGAGAATCCTCAGGAGTGTTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009530.1-7064s1c1
Sequence:CCGGCCTGTCACTTTCACCTCTCAACTCGAGTTGAGAGGTGAAAGTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-542s21c1
Sequence:CCGGCCCACGGATGAGAATGTAAATCTCGAGATTTACATTCTCATCCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-7544s21c1
Sequence:CCGGCCTTCTAACTACCAGCAGATTCTCGAGAATCTGCTGGTAGTTAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-1746s21c1
Sequence:CCGGCCACTAACACTCCTGAGGATTCTCGAGAATCCTCAGGAGTGTTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009530.2-1412s21c1
Sequence:CCGGGCTATGAAGTTATGTCAACTTCTCGAGAAGTTGACATAACTTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)