EMAIL THIS PAGE TO A FRIEND

ATXN10

ataxin 10

112 Gene Product Result for
Synonyms: E46L HUMEEP SCA10
UniProtKB ID: Q9UBB4, A6NLC4, B4DG05, O14998, O15009, Q6I9X4
Gene ID:
Human(25814) Summary: This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of a pentanucleotide repeat in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
Mouse(54138) ataxin 10
Rat(170821) ataxin 10
sheep(101109264) ataxin 10
cow(767990) ataxin 10
chicken(418245) ataxin 10
dog(474467) ataxin 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013236 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013236 Rosetta Predictions human pricing
NM_133313 Rosetta Predictions rat pricing
NM_016843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149918 predicted 691
2 SASI_Hs01_00149919 predicted 1009
3 SASI_Hs01_00149920 predicted 1367
4 SASI_Hs01_00149921 predicted 791
5 SASI_Hs01_00149922 predicted 1346
6 SASI_Hs01_00149923 predicted 1503
7 SASI_Hs01_00149924 predicted 893
8 SASI_Hs01_00149926 predicted 667
9 SASI_Hs01_00149927 predicted 1775
10 SASI_Hs02_00344430 predicted 487
11 SASI_Hs01_00149925 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078070 predicted 768
2 SASI_Rn01_00078071 predicted 625
3 SASI_Rn01_00078072 predicted 370
4 SASI_Rn01_00078073 predicted 1186
5 SASI_Rn02_00267618 predicted 1506
6 SASI_Rn01_00078074 predicted 1260
7 SASI_Rn01_00078075 predicted 640
8 SASI_Rn01_00078076 predicted 899
9 SASI_Rn01_00078077 predicted 790
10 SASI_Rn01_00078078 predicted 463
11 SASI_Rn01_00078079 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323612 predicted 683
2 SASI_Mm01_00139960 predicted 629
3 SASI_Mm01_00139962 predicted 568
4 SASI_Mm01_00139963 predicted 1255
5 SASI_Mm01_00139964 predicted 578
6 SASI_Mm02_00323613 predicted 821
7 SASI_Mm01_00139967 predicted 966
8 SASI_Mm02_00323614 predicted 624
9 SASI_Mm01_00139968 predicted 808
10 SASI_Mm02_00323615 predicted 998
11 SASI_Mm01_00139959 predicted 325
12 SASI_Mm01_00139961 predicted 626
13 SASI_Mm01_00139965 predicted 335
14 SASI_Mm01_00139966 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016843
VALIDATED
ATXN10 MISSION shRNA Bacterial Glycerol Stock
ataxin 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-541s1c1
Sequence:CCGGGTTCTTCTCTTTCGTGAACTTCTCGAGAAGTTCACGAAAGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-1495s1c1
Sequence:CCGGCCAAGATGTCATTGCCAAGATCTCGAGATCTTGGCAATGACATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178777    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-1496s1c1
Sequence:CCGGCAAGATGTCATTGCCAAGATGCTCGAGCATCTTGGCAATGACATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-432s1c1
Sequence:CCGGGCAGCTAATCACTGAATGCTTCTCGAGAAGCATTCAGTGATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-1380s21c1
Sequence:CCGGCCAAGATGTCATTGCCAAGATCTCGAGATCTTGGCAATGACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016843.3-318s21c1
Sequence:CCGGGCAGCTAATCACTGAATGCTTCTCGAGAAGCATTCAGTGATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-1723s21c1
Sequence:CCGGACTCGCTTTCCCGTCATATACCTCGAGGTATATGACGGGAAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-1473s21c1
Sequence:CCGGACTGATTCTGAAGTCTAATAACTCGAGTTATTAGACTTCAGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-427s21c1
Sequence:CCGGGTTCTTCTCTTTCGTGAACTTCTCGAGAAGTTCACGAAAGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016843
VALIDATED
ATXN10 MISSION shRNA shRNA Plasmid DNA
ataxin 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-541s1c1
Sequence:CCGGGTTCTTCTCTTTCGTGAACTTCTCGAGAAGTTCACGAAAGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-1495s1c1
Sequence:CCGGCCAAGATGTCATTGCCAAGATCTCGAGATCTTGGCAATGACATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178777    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-1496s1c1
Sequence:CCGGCAAGATGTCATTGCCAAGATGCTCGAGCATCTTGGCAATGACATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-432s1c1
Sequence:CCGGGCAGCTAATCACTGAATGCTTCTCGAGAAGCATTCAGTGATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-1380s21c1
Sequence:CCGGCCAAGATGTCATTGCCAAGATCTCGAGATCTTGGCAATGACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016843.3-318s21c1
Sequence:CCGGGCAGCTAATCACTGAATGCTTCTCGAGAAGCATTCAGTGATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-1723s21c1
Sequence:CCGGACTCGCTTTCCCGTCATATACCTCGAGGTATATGACGGGAAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-1473s21c1
Sequence:CCGGACTGATTCTGAAGTCTAATAACTCGAGTTATTAGACTTCAGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-427s21c1
Sequence:CCGGGTTCTTCTCTTTCGTGAACTTCTCGAGAAGTTCACGAAAGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016843
VALIDATED
ATXN10 MISSION shRNA Lentiviral Transduction Particles
ataxin 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-541s1c1
Sequence:CCGGGTTCTTCTCTTTCGTGAACTTCTCGAGAAGTTCACGAAAGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-1495s1c1
Sequence:CCGGCCAAGATGTCATTGCCAAGATCTCGAGATCTTGGCAATGACATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178777    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-1496s1c1
Sequence:CCGGCAAGATGTCATTGCCAAGATGCTCGAGCATCTTGGCAATGACATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016843.1-432s1c1
Sequence:CCGGGCAGCTAATCACTGAATGCTTCTCGAGAAGCATTCAGTGATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-1380s21c1
Sequence:CCGGCCAAGATGTCATTGCCAAGATCTCGAGATCTTGGCAATGACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016843.3-318s21c1
Sequence:CCGGGCAGCTAATCACTGAATGCTTCTCGAGAAGCATTCAGTGATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-1723s21c1
Sequence:CCGGACTCGCTTTCCCGTCATATACCTCGAGGTATATGACGGGAAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-1473s21c1
Sequence:CCGGACTGATTCTGAAGTCTAATAACTCGAGTTATTAGACTTCAGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016843.3-427s21c1
Sequence:CCGGGTTCTTCTCTTTCGTGAACTTCTCGAGAAGTTCACGAAAGAGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013236
VALIDATED
ATXN10 MISSION shRNA Bacterial Glycerol Stock
ataxin 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-1531s1c1
Sequence:CCGGGCAGATGCATCCCTACTTAAACTCGAGTTTAAGTAGGGATGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013236.1-432s1c1
Sequence:CCGGGCAGTTAATAACAGAATGCTTCTCGAGAAGCATTCTGTTATTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-325s1c1
Sequence:CCGGCCCAGGACTATCTTCCAAAGACTCGAGTCTTTGGAAGATAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-904s1c1
Sequence:CCGGCCCAAACTGAACAATCAAGAACTCGAGTTCTTGATTGTTCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-1125s1c1
Sequence:CCGGCCTGTGCGAAATGACTGTGAACTCGAGTTCACAGTCATTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013236.2-1814s21c1
Sequence:CCGGTAGTAGAGTTTAACGTGTATACTCGAGTATACACGTTAAACTCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-1498s21c1
Sequence:CCGGTGACCCAGTGGGTGATATATGCTCGAGCATATATCACCCACTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-963s21c1
Sequence:CCGGCCCAAACTGAACAATCAAGAACTCGAGTTCTTGATTGTTCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-1590s21c1
Sequence:CCGGGCAGATGCATCCCTACTTAAACTCGAGTTTAAGTAGGGATGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-1184s21c1
Sequence:CCGGCCTGTGCGAAATGACTGTGAACTCGAGTTCACAGTCATTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013236
VALIDATED
ATXN10 MISSION shRNA shRNA Plasmid DNA
ataxin 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-1531s1c1
Sequence:CCGGGCAGATGCATCCCTACTTAAACTCGAGTTTAAGTAGGGATGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013236.1-432s1c1
Sequence:CCGGGCAGTTAATAACAGAATGCTTCTCGAGAAGCATTCTGTTATTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-325s1c1
Sequence:CCGGCCCAGGACTATCTTCCAAAGACTCGAGTCTTTGGAAGATAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-904s1c1
Sequence:CCGGCCCAAACTGAACAATCAAGAACTCGAGTTCTTGATTGTTCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-1125s1c1
Sequence:CCGGCCTGTGCGAAATGACTGTGAACTCGAGTTCACAGTCATTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013236.2-1814s21c1
Sequence:CCGGTAGTAGAGTTTAACGTGTATACTCGAGTATACACGTTAAACTCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-1498s21c1
Sequence:CCGGTGACCCAGTGGGTGATATATGCTCGAGCATATATCACCCACTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-963s21c1
Sequence:CCGGCCCAAACTGAACAATCAAGAACTCGAGTTCTTGATTGTTCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-1590s21c1
Sequence:CCGGGCAGATGCATCCCTACTTAAACTCGAGTTTAAGTAGGGATGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-1184s21c1
Sequence:CCGGCCTGTGCGAAATGACTGTGAACTCGAGTTCACAGTCATTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013236
VALIDATED
ATXN10 MISSION shRNA Lentiviral Transduction Particles
ataxin 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-1531s1c1
Sequence:CCGGGCAGATGCATCCCTACTTAAACTCGAGTTTAAGTAGGGATGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013236.1-432s1c1
Sequence:CCGGGCAGTTAATAACAGAATGCTTCTCGAGAAGCATTCTGTTATTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-325s1c1
Sequence:CCGGCCCAGGACTATCTTCCAAAGACTCGAGTCTTTGGAAGATAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-904s1c1
Sequence:CCGGCCCAAACTGAACAATCAAGAACTCGAGTTCTTGATTGTTCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013236.1-1125s1c1
Sequence:CCGGCCTGTGCGAAATGACTGTGAACTCGAGTTCACAGTCATTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013236.2-1814s21c1
Sequence:CCGGTAGTAGAGTTTAACGTGTATACTCGAGTATACACGTTAAACTCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-1498s21c1
Sequence:CCGGTGACCCAGTGGGTGATATATGCTCGAGCATATATCACCCACTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-963s21c1
Sequence:CCGGCCCAAACTGAACAATCAAGAACTCGAGTTCTTGATTGTTCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-1590s21c1
Sequence:CCGGGCAGATGCATCCCTACTTAAACTCGAGTTTAAGTAGGGATGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013236.2-1184s21c1
Sequence:CCGGCCTGTGCGAAATGACTGTGAACTCGAGTTCACAGTCATTTCGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks