EMAIL THIS PAGE TO A FRIEND

ATXN1

ataxin 1

379 Gene Product Result for
Synonyms: ATX1 D6S504E SCA1
UniProtKB ID: P54253, Q17S02, Q9UJG2, Q9Y4J1
Gene ID:
Human(6310) Summary: The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 41-81 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). At least two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(20238) ataxin 1
Rat(25049) ataxin 1
chicken(420843) ataxin 1
cow(616399) ataxin 1
Horse(100065748) ataxin 1
dog(488232) ataxin 1
sheep(101113284) ataxin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502711 Anti-Ataxin 1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
HPA008335 Anti-ATXN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA070756 Anti-ATXN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4504079 Anti-phospho-Ataxin 1 (pSer776) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4301530 Anti-phospho-Ataxin 1 (pSer776) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB5201365 Monoclonal Anti-Ataxin - Alkaline Phosphatase antibody produced in mouse clone S76-8, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201366 Monoclonal Anti-Ataxin - Apc antibody produced in mouse clone S76-8, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201357 Monoclonal Anti-Ataxin - Atto 390 antibody produced in mouse clone S76-8, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201358 Monoclonal Anti-Ataxin - Atto 488 antibody produced in mouse clone S76-8, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201359 Monoclonal Anti-Ataxin - Atto 565 antibody produced in mouse clone S76-8, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201360 Monoclonal Anti-Ataxin - Atto 594 antibody produced in mouse clone S76-8, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201361 Monoclonal Anti-Ataxin - Atto 633 antibody produced in mouse clone S76-8, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201362 Monoclonal Anti-Ataxin - Atto 655 antibody produced in mouse clone S76-8, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201363 Monoclonal Anti-Ataxin - Atto 680 antibody produced in mouse clone S76-8, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201364 Monoclonal Anti-Ataxin - Atto 700 antibody produced in mouse clone S76-8, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201367 Monoclonal Anti-Ataxin - Biotin antibody produced in mouse clone S76-8, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201368 Monoclonal Anti-Ataxin - Fitc antibody produced in mouse clone S76-8, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201369 Monoclonal Anti-Ataxin - Hrp antibody produced in mouse clone S76-8, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201370 Monoclonal Anti-Ataxin - Pe/Atto 594 antibody produced in mouse clone S76-8, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201371 Monoclonal Anti-Ataxin - Percp antibody produced in mouse clone S76-8, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201372 Monoclonal Anti-Ataxin - Rpe antibody produced in mouse clone S76-8, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201373 Monoclonal Anti-Ataxin - Streptavidin antibody produced in mouse clone S76-8, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201689 Monoclonal Anti-Ataxin 1 - Alkaline Phosphatase antibody produced in mouse clone S65-37, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201690 Monoclonal Anti-Ataxin 1 - Apc antibody produced in mouse clone S65-37, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201681 Monoclonal Anti-Ataxin 1 - Atto 390 antibody produced in mouse clone S65-37, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5201682 Monoclonal Anti-Ataxin 1 - Atto 488 antibody produced in mouse clone S65-37, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201683 Monoclonal Anti-Ataxin 1 - Atto 565 antibody produced in mouse clone S65-37, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201684 Monoclonal Anti-Ataxin 1 - Atto 594 antibody produced in mouse clone S65-37, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201685 Monoclonal Anti-Ataxin 1 - Atto 633 antibody produced in mouse clone S65-37, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201686 Monoclonal Anti-Ataxin 1 - Atto 655 antibody produced in mouse clone S65-37, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201687 Monoclonal Anti-Ataxin 1 - Atto 680 antibody produced in mouse clone S65-37, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201688 Monoclonal Anti-Ataxin 1 - Atto 700 antibody produced in mouse clone S65-37, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5201691 Monoclonal Anti-Ataxin 1 - Biotin antibody produced in mouse clone S65-37, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201692 Monoclonal Anti-Ataxin 1 - Fitc antibody produced in mouse clone S65-37, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201693 Monoclonal Anti-Ataxin 1 - Hrp antibody produced in mouse clone S65-37, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201694 Monoclonal Anti-Ataxin 1 - Pe/Atto 594 antibody produced in mouse clone S65-37, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5201695 Monoclonal Anti-Ataxin 1 - Percp antibody produced in mouse clone S65-37, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201696 Monoclonal Anti-Ataxin 1 - Rpe antibody produced in mouse clone S65-37, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5201697 Monoclonal Anti-Ataxin 1 - Streptavidin antibody produced in mouse clone S65-37, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5201356 Monoclonal Anti-Ataxin 1 antibody produced in mouse clone S76-8, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201680 Monoclonal Anti-Ataxin 1 antibody produced in mouse clone S65-37, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB1402905 Monoclonal Anti-ATXN1 antibody produced in mouse clone 4C5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300337 Monoclonal Anti-ATXN1 antibody produced in mouse clone 2F5, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000332 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000332 Rosetta Predictions human pricing
NM_001128164 Rosetta Predictions human pricing
NM_012726 Rosetta Predictions rat pricing
NM_009124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189228 predicted 3032
2 SASI_Hs01_00189229 predicted 3347
3 SASI_Hs02_00302349 predicted 1180
4 SASI_Hs01_00189230 predicted 2774
5 SASI_Hs01_00189231 predicted 2948
6 SASI_Hs01_00189232 predicted 3353
7 SASI_Hs01_00189233 predicted 3334
8 SASI_Hs01_00189234 predicted 3398
9 SASI_Hs01_00189235 predicted 3430
10 SASI_Hs01_00189236 predicted 2067
11 SASI_Hs01_00189237 predicted 3462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330646 predicted 2985
2 SASI_Hs02_00330647 predicted 3290
3 SASI_Hs02_00330648 predicted 1138
4 SASI_Hs02_00330649 predicted 2720
5 SASI_Hs02_00330650 predicted 2901
6 SASI_Hs02_00330651 predicted 3306
7 SASI_Hs02_00330652 predicted 3284
8 SASI_Hs02_00330653 predicted 3348
9 SASI_Hs02_00330654 predicted 3380
10 SASI_Hs02_00330655 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115023 predicted 1227
2 SASI_Rn01_00115024 predicted 2723
3 SASI_Rn01_00115025 predicted 3013
4 SASI_Rn01_00115026 predicted 2760
5 SASI_Rn01_00115027 predicted 2047
6 SASI_Rn01_00115029 predicted 3011
7 SASI_Rn01_00115030 predicted 2295
8 SASI_Rn01_00115031 predicted 2821
9 SASI_Rn02_00260070 predicted 2531
10 SASI_Rn01_00115032 predicted 2945
11 SASI_Rn01_00115028 predicted 4036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075893 predicted 1092
2 SASI_Mm01_00075894 predicted 2640
3 SASI_Mm01_00075896 predicted 3242
4 SASI_Mm01_00075897 predicted 2881
5 SASI_Mm01_00075898 predicted 3204
6 SASI_Mm02_00315412 predicted 2623
7 SASI_Mm01_00075899 predicted 1915
8 SASI_Mm01_00075900 predicted 2167
9 SASI_Mm01_00075901 predicted 1642
10 SASI_Mm01_00075902 predicted 2812
11 SASI_Mm01_00075895 predicted 1961
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000332
ATXN1 MISSION shRNA Bacterial Glycerol Stock
ataxin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000332.3-3471s21c1
Sequence:CCGGATTACTGTACTGTAGGCTAAACTCGAGTTTAGCCTACAGTACAGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000332.3-1182s21c1
Sequence:CCGGTTACAACAGGGAATAGGTTTACTCGAGTAAACCTATTCCCTGTTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000332.x-8369s1c1
Sequence:CCGGCGCTTCAAATACGTTACCTTACTCGAGTAAGGTAACGTATTTGAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-1668s1c1
Sequence:CCGGCAGAACCAGTACGTCCACATTCTCGAGAATGTGGACGTACTGGTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-3339s1c1
Sequence:CCGGCAGGAGGTTAAGATTTGCATTCTCGAGAATGCAAATCTTAACCTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-2785s1c1
Sequence:CCGGAGAGGATTGAAGACAGCCATACTCGAGTATGGCTGTCTTCAATCCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-3302s1c1
Sequence:CCGGACCACCTTTGACTCTTCCTAACTCGAGTTAGGAAGAGTCAAAGGTGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000332
ATXN1 MISSION shRNA shRNA Plasmid DNA
ataxin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000332.3-3471s21c1
Sequence:CCGGATTACTGTACTGTAGGCTAAACTCGAGTTTAGCCTACAGTACAGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000332.3-1182s21c1
Sequence:CCGGTTACAACAGGGAATAGGTTTACTCGAGTAAACCTATTCCCTGTTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000332.x-8369s1c1
Sequence:CCGGCGCTTCAAATACGTTACCTTACTCGAGTAAGGTAACGTATTTGAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-1668s1c1
Sequence:CCGGCAGAACCAGTACGTCCACATTCTCGAGAATGTGGACGTACTGGTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-3339s1c1
Sequence:CCGGCAGGAGGTTAAGATTTGCATTCTCGAGAATGCAAATCTTAACCTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-2785s1c1
Sequence:CCGGAGAGGATTGAAGACAGCCATACTCGAGTATGGCTGTCTTCAATCCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-3302s1c1
Sequence:CCGGACCACCTTTGACTCTTCCTAACTCGAGTTAGGAAGAGTCAAAGGTGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000332
ATXN1 MISSION shRNA Lentiviral Transduction Particles
ataxin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000332.3-3471s21c1
Sequence:CCGGATTACTGTACTGTAGGCTAAACTCGAGTTTAGCCTACAGTACAGTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000332.3-1182s21c1
Sequence:CCGGTTACAACAGGGAATAGGTTTACTCGAGTAAACCTATTCCCTGTTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000332.x-8369s1c1
Sequence:CCGGCGCTTCAAATACGTTACCTTACTCGAGTAAGGTAACGTATTTGAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-1668s1c1
Sequence:CCGGCAGAACCAGTACGTCCACATTCTCGAGAATGTGGACGTACTGGTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-3339s1c1
Sequence:CCGGCAGGAGGTTAAGATTTGCATTCTCGAGAATGCAAATCTTAACCTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-2785s1c1
Sequence:CCGGAGAGGATTGAAGACAGCCATACTCGAGTATGGCTGTCTTCAATCCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000332.x-3302s1c1
Sequence:CCGGACCACCTTTGACTCTTCCTAACTCGAGTTAGGAAGAGTCAAAGGTGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009124
VALIDATED
ATXN1 MISSION shRNA Bacterial Glycerol Stock
ataxin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009124.5-2594s21c1
Sequence:CCGGGGACCTGAAGACGGAGGATTTCTCGAGAAATCCTCCGTCTTCAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009124.5-3830s21c1
Sequence:CCGGACGTGGTTCTCTCCAACATATCTCGAGATATGTTGGAGAGAACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009124.5-1925s21c1
Sequence:CCGGAGACTACAGCAGTCGTGATACCTCGAGGTATCACGACTGCTGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_009124.5-1551s1c1
Sequence:CCGGCAGAACCAGTACATCCATATTCTCGAGAATATGGATGTACTGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009124.5-1964s21c1
Sequence:CCGGTGTGATGGTTCTGCCTAATAGCTCGAGCTATTAGGCAGAACCATCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009124.5-3237s21c1
Sequence:CCGGTGCATCGAAGGCCGATCTAACCTCGAGGTTAGATCGGCCTTCGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_009124.2-2747s1c1
Sequence:CCGGGTCGAAGTCTTGGTAGAGTATCTCGAGATACTCTACCAAGACTTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175574    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009124.2-3590s1c1
Sequence:CCGGCCCACTGGTTTCAAGAACAAACTCGAGTTTGTTCTTGAAACCAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009124.2-2702s1c1
Sequence:CCGGGCCGTGATACAGTTTGCTGTTCTCGAGAACAGCAAACTGTATCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009124
VALIDATED
ATXN1 MISSION shRNA shRNA Plasmid DNA
ataxin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009124.5-2594s21c1
Sequence:CCGGGGACCTGAAGACGGAGGATTTCTCGAGAAATCCTCCGTCTTCAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009124.5-3830s21c1
Sequence:CCGGACGTGGTTCTCTCCAACATATCTCGAGATATGTTGGAGAGAACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009124.5-1925s21c1
Sequence:CCGGAGACTACAGCAGTCGTGATACCTCGAGGTATCACGACTGCTGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_009124.5-1551s1c1
Sequence:CCGGCAGAACCAGTACATCCATATTCTCGAGAATATGGATGTACTGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009124.5-1964s21c1
Sequence:CCGGTGTGATGGTTCTGCCTAATAGCTCGAGCTATTAGGCAGAACCATCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009124.5-3237s21c1
Sequence:CCGGTGCATCGAAGGCCGATCTAACCTCGAGGTTAGATCGGCCTTCGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_009124.2-2747s1c1
Sequence:CCGGGTCGAAGTCTTGGTAGAGTATCTCGAGATACTCTACCAAGACTTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175574    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009124.2-3590s1c1
Sequence:CCGGCCCACTGGTTTCAAGAACAAACTCGAGTTTGTTCTTGAAACCAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009124.2-2702s1c1
Sequence:CCGGGCCGTGATACAGTTTGCTGTTCTCGAGAACAGCAAACTGTATCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009124
VALIDATED
ATXN1 MISSION shRNA Lentiviral Transduction Particles
ataxin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009124.5-2594s21c1
Sequence:CCGGGGACCTGAAGACGGAGGATTTCTCGAGAAATCCTCCGTCTTCAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009124.5-3830s21c1
Sequence:CCGGACGTGGTTCTCTCCAACATATCTCGAGATATGTTGGAGAGAACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009124.5-1925s21c1
Sequence:CCGGAGACTACAGCAGTCGTGATACCTCGAGGTATCACGACTGCTGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_009124.5-1551s1c1
Sequence:CCGGCAGAACCAGTACATCCATATTCTCGAGAATATGGATGTACTGGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009124.5-1964s21c1
Sequence:CCGGTGTGATGGTTCTGCCTAATAGCTCGAGCTATTAGGCAGAACCATCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009124.5-3237s21c1
Sequence:CCGGTGCATCGAAGGCCGATCTAACCTCGAGGTTAGATCGGCCTTCGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_009124.2-2747s1c1
Sequence:CCGGGTCGAAGTCTTGGTAGAGTATCTCGAGATACTCTACCAAGACTTCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175574    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009124.2-3590s1c1
Sequence:CCGGCCCACTGGTTTCAAGAACAAACTCGAGTTTGTTCTTGAAACCAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009124.2-2702s1c1
Sequence:CCGGGCCGTGATACAGTTTGCTGTTCTCGAGAACAGCAAACTGTATCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)