EMAIL THIS PAGE TO A FRIEND

ATXN1L

ataxin 1-like

88 Gene Product Result for
Synonyms: BOAT BOAT1
UniProtKB ID: P0C7T5
Gene ID:
Mouse(52335) ataxin 1-like
Rat(307970) ataxin 1-like
Zebrafish(793927) ataxin 1-like
cow(521025) ataxin 1-like
domestic cat(101101276) ataxin 1-like
dog(489725) ataxin 1-like
chicken(427566) ataxin 1-like
sheep(101103748) ataxin 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001137675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001137675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001137675 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001724473 Rosetta Predictions human pricing
XM_001724532 Rosetta Predictions human pricing
XM_292512 Rosetta Predictions human pricing
XM_928464 Rosetta Predictions human pricing
XM_001077096 Rosetta Predictions rat pricing
XM_226598 Rosetta Predictions rat pricing
NM_001080930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00461920 predicted 2092
2 SASI_Hs02_00461921 predicted 1611
3 SASI_Hs02_00461922 predicted 766
4 SASI_Hs02_00461923 predicted 281
5 SASI_Hs02_00461924 predicted 1268
6 SASI_Hs02_00461925 predicted 498
7 SASI_Hs02_00461926 predicted 1774
8 SASI_Hs02_00461927 predicted 2093
9 SASI_Hs02_00461928 predicted 284
10 SASI_Hs02_00461929 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00462296 predicted 2090
2 SASI_Hs02_00462297 predicted 1615
3 SASI_Hs02_00462298 predicted 767
4 SASI_Hs02_00462299 predicted 285
5 SASI_Hs02_00462300 predicted 1274
6 SASI_Hs02_00462301 predicted 492
7 SASI_Hs02_00462302 predicted 1778
8 SASI_Hs02_00462303 predicted 2092
9 SASI_Hs02_00462304 predicted 289
10 SASI_Hs02_00462305 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269663 predicted 254
2 SASI_Hs01_00269664 predicted 208
3 SASI_Hs01_00269665 predicted 669
4 SASI_Hs01_00269666 predicted 441
5 SASI_Hs01_00269667 predicted 461
6 SASI_Hs01_00269668 predicted 518
7 SASI_Hs01_00269669 predicted 217
8 SASI_Hs01_00269670 predicted 434
9 SASI_Hs01_00269671 predicted 622
10 SASI_Hs01_00269672 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295583 predicted 2088
2 SASI_Hs02_00480858 predicted 1614
3 SASI_Hs01_00295584 predicted 772
4 SASI_Hs02_00480859 predicted 287
5 SASI_Hs01_00295586 predicted 1276
6 SASI_Hs01_00295587 predicted 494
7 SASI_Hs01_00295588 predicted 1770
8 SASI_Hs02_00480860 predicted 2093
9 SASI_Hs02_00480861 predicted 281
10 SASI_Hs01_00295591 predicted 574
11 SASI_Hs01_00295582 predicted 1488
12 SASI_Hs01_00295585 predicted 1310
13 SASI_Hs01_00295589 predicted 1104
14 SASI_Hs01_00295590 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355766 predicted 473
2 SASI_Rn02_00355767 predicted 1787
3 SASI_Rn02_00355768 predicted 1303
4 SASI_Rn02_00355769 predicted 387
5 SASI_Rn02_00355770 predicted 276
6 SASI_Rn02_00355771 predicted 572
7 SASI_Rn02_00355772 predicted 1469
8 SASI_Rn02_00355773 predicted 207
9 SASI_Rn02_00355774 predicted 1622
10 SASI_Rn02_00355775 predicted 1882
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383705 predicted 470
2 SASI_Rn02_00383706 predicted 1792
3 SASI_Rn02_00383707 predicted 1309
4 SASI_Rn02_00383708 predicted 387
5 SASI_Rn02_00383709 predicted 272
6 SASI_Rn02_00383710 predicted 570
7 SASI_Rn02_00383711 predicted 1474
8 SASI_Rn02_00383712 predicted 207
9 SASI_Rn02_00383713 predicted 1621
10 SASI_Rn02_00383714 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294003 predicted 1164
2 SASI_Mm02_00294004 predicted 1052
3 SASI_Mm02_00294005 predicted 2380
4 SASI_Mm02_00294006 predicted 1909
5 SASI_Mm02_00294007 predicted 1024
6 SASI_Mm02_00294008 predicted 1155
7 SASI_Mm02_00294009 predicted 780
8 SASI_Mm02_00294010 predicted 2086
9 SASI_Mm02_00294011 predicted 666
10 SASI_Mm02_00294012 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137675
ATXN1L MISSION shRNA Bacterial Glycerol Stock
ataxin 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-1104s21c1
Sequence:CCGGGAGACCACGAGAGCGAAATTTCTCGAGAAATTTCGCTCTCGTGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-729s21c1
Sequence:CCGGCTATGCTGTGCCACCTAATTTCTCGAGAAATTAGGTGGCACAGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137675.2-6399s21c1
Sequence:CCGGTTGAGGAGCTGAACCTTATTACTCGAGTAATAAGGTTCAGCTCCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-957s21c1
Sequence:CCGGTCCAGGTCGGATGCCCATTTACTCGAGTAAATGGGCATCCGACCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-2014s21c1
Sequence:CCGGGTCTGCATCTCTATCAGTTTACTCGAGTAAACTGATAGAGATGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137675
ATXN1L MISSION shRNA shRNA Plasmid DNA
ataxin 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-1104s21c1
Sequence:CCGGGAGACCACGAGAGCGAAATTTCTCGAGAAATTTCGCTCTCGTGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-729s21c1
Sequence:CCGGCTATGCTGTGCCACCTAATTTCTCGAGAAATTAGGTGGCACAGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137675.2-6399s21c1
Sequence:CCGGTTGAGGAGCTGAACCTTATTACTCGAGTAATAAGGTTCAGCTCCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-957s21c1
Sequence:CCGGTCCAGGTCGGATGCCCATTTACTCGAGTAAATGGGCATCCGACCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-2014s21c1
Sequence:CCGGGTCTGCATCTCTATCAGTTTACTCGAGTAAACTGATAGAGATGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137675
ATXN1L MISSION shRNA Lentiviral Transduction Particles
ataxin 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-1104s21c1
Sequence:CCGGGAGACCACGAGAGCGAAATTTCTCGAGAAATTTCGCTCTCGTGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-729s21c1
Sequence:CCGGCTATGCTGTGCCACCTAATTTCTCGAGAAATTAGGTGGCACAGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137675.2-6399s21c1
Sequence:CCGGTTGAGGAGCTGAACCTTATTACTCGAGTAATAAGGTTCAGCTCCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-957s21c1
Sequence:CCGGTCCAGGTCGGATGCCCATTTACTCGAGTAAATGGGCATCCGACCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137675.2-2014s21c1
Sequence:CCGGGTCTGCATCTCTATCAGTTTACTCGAGTAAACTGATAGAGATGCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080930
VALIDATED
ATXN1L MISSION shRNA Bacterial Glycerol Stock
ataxin 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080930.1-1429s21c1
Sequence:CCGGCTTAACCTATCCCATCATAACCTCGAGGTTATGATGGGATAGGTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080930.1-4567s21c1
Sequence:CCGGACTCATTCCTAGGTGTTATTTCTCGAGAAATAACACCTAGGAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080930.1-977s21c1
Sequence:CCGGAGTTGCCACATCACTCGAATACTCGAGTATTCGAGTGATGTGGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080930.1-789s21c1
Sequence:CCGGTTATGCTGTGCCACCTAATTTCTCGAGAAATTAGGTGGCACAGCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080930.1-1050s21c1
Sequence:CCGGTAGGCTACCTGCTGGATATACCTCGAGGTATATCCAGCAGGTAGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080930
VALIDATED
ATXN1L MISSION shRNA shRNA Plasmid DNA
ataxin 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080930.1-1429s21c1
Sequence:CCGGCTTAACCTATCCCATCATAACCTCGAGGTTATGATGGGATAGGTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080930.1-4567s21c1
Sequence:CCGGACTCATTCCTAGGTGTTATTTCTCGAGAAATAACACCTAGGAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080930.1-977s21c1
Sequence:CCGGAGTTGCCACATCACTCGAATACTCGAGTATTCGAGTGATGTGGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080930.1-789s21c1
Sequence:CCGGTTATGCTGTGCCACCTAATTTCTCGAGAAATTAGGTGGCACAGCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080930.1-1050s21c1
Sequence:CCGGTAGGCTACCTGCTGGATATACCTCGAGGTATATCCAGCAGGTAGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080930
VALIDATED
ATXN1L MISSION shRNA Lentiviral Transduction Particles
ataxin 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080930.1-1429s21c1
Sequence:CCGGCTTAACCTATCCCATCATAACCTCGAGGTTATGATGGGATAGGTTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080930.1-4567s21c1
Sequence:CCGGACTCATTCCTAGGTGTTATTTCTCGAGAAATAACACCTAGGAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080930.1-977s21c1
Sequence:CCGGAGTTGCCACATCACTCGAATACTCGAGTATTCGAGTGATGTGGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080930.1-789s21c1
Sequence:CCGGTTATGCTGTGCCACCTAATTTCTCGAGAAATTAGGTGGCACAGCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080930.1-1050s21c1
Sequence:CCGGTAGGCTACCTGCTGGATATACCTCGAGGTATATCCAGCAGGTAGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)