EMAIL THIS PAGE TO A FRIEND

ATXN2

ataxin 2

166 Gene Product Result for
Synonyms: ASL13 ATX2 SCA2 TNRC13
UniProtKB ID: Q99700, A6NLD4, Q6ZQZ7, Q99493
Gene ID:
Human(6311) Summary: The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. Defects in this gene are the cause of spinocerebellar ataxia type 2 (SCA2). SCA2 belongs to the autosomal dominant cerebellar ataxias type I (ADCA I) which are characterized by cerebellar ataxia in combination with additional clinical features like optic atrophy, ophthalmoplegia, bulbar and extrapyramidal signs, peripheral neuropathy and dementia. SCA2 is caused by expansion of a CAG repeat in the coding region of this gene. This locus has been mapped to chromosome 12, and it has been determined that the diseased allele contains 37-50 CAG repeats, compared to 17-29 in the normal allele. Longer expansions result in earlier onset of the disease. Alternatively spliced transcript variants encoding different isoforms have been identified but their full length sequence has not been determined. [provided by RefSeq, Jan 2010]
Mouse(20239) ataxin 2
Rat(288663) ataxin 2
sheep(101106796) ataxin 2
dog(486270) ataxin 2
Horse(100057794) ataxin 2
cow(532649) ataxin 2
chicken(416877) ataxin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002973 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002973 Rosetta Predictions human pricing
NM_001105930 Rosetta Predictions rat pricing
NM_009125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159982 predicted 3463
2 SASI_Hs01_00159984 predicted 948
3 SASI_Hs01_00159985 predicted 1230
4 SASI_Hs02_00334844 predicted 3108
5 SASI_Hs01_00159986 predicted 3249
6 SASI_Hs01_00159987 predicted 2394
7 SASI_Hs01_00159989 predicted 1406
8 SASI_Hs01_00159990 predicted 2917
9 SASI_Hs02_00334845 predicted 3267
10 SASI_Hs02_00334846 predicted 2377
11 SASI_Hs01_00159983 predicted 2299
12 SASI_Hs01_00159988 predicted 1397
13 SASI_Hs01_00159991 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213942 predicted 2396
2 SASI_Rn02_00213943 predicted 1154
3 SASI_Rn02_00213944 predicted 2294
4 SASI_Rn02_00213945 predicted 1217
5 SASI_Rn02_00213946 predicted 2403
6 SASI_Rn02_00213947 predicted 2099
7 SASI_Rn02_00213948 predicted 1600
8 SASI_Rn02_00213949 predicted 2261
9 SASI_Rn02_00213950 predicted 1530
10 SASI_Rn02_00213951 predicted 2336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117582 predicted 718
2 SASI_Mm01_00117584 predicted 3149
3 SASI_Mm01_00117585 predicted 2201
4 SASI_Mm01_00117586 predicted 2862
5 SASI_Mm01_00117587 predicted 3267
6 SASI_Mm01_00117588 predicted 3683
7 SASI_Mm01_00117589 predicted 3831
8 SASI_Mm01_00117590 predicted 739
9 SASI_Mm02_00315413 predicted 1119
10 SASI_Mm02_00315414 predicted 3111
11 SASI_Mm01_00117581 predicted 2928
12 SASI_Mm01_00117583 predicted 824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002973
VALIDATED
ATXN2 MISSION shRNA Bacterial Glycerol Stock
ataxin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-4542s21c1
Sequence:CCGGCGTCAAACTGACGGATTATTACTCGAGTAATAATCCGTCAGTTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-3028s21c1
Sequence:CCGGCCAGTTTATACTCAGCCTGTTCTCGAGAACAGGCTGAGTATAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-1057s21c1
Sequence:CCGGCCGAAGTGTGATTTGGTACTTCTCGAGAAGTACCAAATCACACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-918s21c1
Sequence:CCGGGCCTCAGTCTACGATTTCTTTCTCGAGAAAGAAATCGTAGACTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-3257s21c1
Sequence:CCGGCAGCTTACTCCACGCAATATGCTCGAGCATATTGCGTGGAGTAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002973.1-2293s1c1
Sequence:CCGGGCTGGTATTATTCCAACTGAACTCGAGTTCAGTTGGAATAATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002973.1-3139s1c1
Sequence:CCGGGCCAAGACATATAGAGCAGTACTCGAGTACTGCTCTATATGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002973.1-1054s1c1
Sequence:CCGGCCGAAGTGTGATTTGGTACTTCTCGAGAAGTACCAAATCACACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002973.1-3025s1c1
Sequence:CCGGCCAGTTTATACTCAGCCTGTTCTCGAGAACAGGCTGAGTATAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002973.1-915s1c1
Sequence:CCGGGCCTCAGTCTACGATTTCTTTCTCGAGAAAGAAATCGTAGACTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002973
VALIDATED
ATXN2 MISSION shRNA shRNA Plasmid DNA
ataxin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-4542s21c1
Sequence:CCGGCGTCAAACTGACGGATTATTACTCGAGTAATAATCCGTCAGTTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-3028s21c1
Sequence:CCGGCCAGTTTATACTCAGCCTGTTCTCGAGAACAGGCTGAGTATAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-1057s21c1
Sequence:CCGGCCGAAGTGTGATTTGGTACTTCTCGAGAAGTACCAAATCACACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-918s21c1
Sequence:CCGGGCCTCAGTCTACGATTTCTTTCTCGAGAAAGAAATCGTAGACTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-3257s21c1
Sequence:CCGGCAGCTTACTCCACGCAATATGCTCGAGCATATTGCGTGGAGTAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002973.1-2293s1c1
Sequence:CCGGGCTGGTATTATTCCAACTGAACTCGAGTTCAGTTGGAATAATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002973.1-3139s1c1
Sequence:CCGGGCCAAGACATATAGAGCAGTACTCGAGTACTGCTCTATATGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002973.1-1054s1c1
Sequence:CCGGCCGAAGTGTGATTTGGTACTTCTCGAGAAGTACCAAATCACACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002973.1-3025s1c1
Sequence:CCGGCCAGTTTATACTCAGCCTGTTCTCGAGAACAGGCTGAGTATAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002973.1-915s1c1
Sequence:CCGGGCCTCAGTCTACGATTTCTTTCTCGAGAAAGAAATCGTAGACTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002973
VALIDATED
ATXN2 MISSION shRNA Lentiviral Transduction Particles
ataxin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-4542s21c1
Sequence:CCGGCGTCAAACTGACGGATTATTACTCGAGTAATAATCCGTCAGTTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-3028s21c1
Sequence:CCGGCCAGTTTATACTCAGCCTGTTCTCGAGAACAGGCTGAGTATAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-1057s21c1
Sequence:CCGGCCGAAGTGTGATTTGGTACTTCTCGAGAAGTACCAAATCACACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-918s21c1
Sequence:CCGGGCCTCAGTCTACGATTTCTTTCTCGAGAAAGAAATCGTAGACTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002973.3-3257s21c1
Sequence:CCGGCAGCTTACTCCACGCAATATGCTCGAGCATATTGCGTGGAGTAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002973.1-2293s1c1
Sequence:CCGGGCTGGTATTATTCCAACTGAACTCGAGTTCAGTTGGAATAATACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002973.1-3139s1c1
Sequence:CCGGGCCAAGACATATAGAGCAGTACTCGAGTACTGCTCTATATGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002973.1-1054s1c1
Sequence:CCGGCCGAAGTGTGATTTGGTACTTCTCGAGAAGTACCAAATCACACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002973.1-3025s1c1
Sequence:CCGGCCAGTTTATACTCAGCCTGTTCTCGAGAACAGGCTGAGTATAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002973.1-915s1c1
Sequence:CCGGGCCTCAGTCTACGATTTCTTTCTCGAGAAAGAAATCGTAGACTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009125
ATXN2 MISSION shRNA Bacterial Glycerol Stock
ataxin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009125.1-3902s1c1
Sequence:CCGGCGAAAGGCCAAATCCCTTCTTCTCGAGAAGAAGGGATTTGGCCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-1858s1c1
Sequence:CCGGCCATGTCTAGTGGCCTAGAATCTCGAGATTCTAGGCCACTAGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-754s1c1
Sequence:CCGGCGTCAGTTGTTGGATCGAAATCTCGAGATTTCGATCCAACAACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-2440s1c1
Sequence:CCGGCGGAAGCAAGTGCTAAGGATACTCGAGTATCCTTAGCACTTGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-3143s1c1
Sequence:CCGGCAGTCCTGTCATACAAGGTAACTCGAGTTACCTTGTATGACAGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009125
ATXN2 MISSION shRNA shRNA Plasmid DNA
ataxin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009125.1-3902s1c1
Sequence:CCGGCGAAAGGCCAAATCCCTTCTTCTCGAGAAGAAGGGATTTGGCCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-1858s1c1
Sequence:CCGGCCATGTCTAGTGGCCTAGAATCTCGAGATTCTAGGCCACTAGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-754s1c1
Sequence:CCGGCGTCAGTTGTTGGATCGAAATCTCGAGATTTCGATCCAACAACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-2440s1c1
Sequence:CCGGCGGAAGCAAGTGCTAAGGATACTCGAGTATCCTTAGCACTTGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-3143s1c1
Sequence:CCGGCAGTCCTGTCATACAAGGTAACTCGAGTTACCTTGTATGACAGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009125
ATXN2 MISSION shRNA Lentiviral Transduction Particles
ataxin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009125.1-3902s1c1
Sequence:CCGGCGAAAGGCCAAATCCCTTCTTCTCGAGAAGAAGGGATTTGGCCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-1858s1c1
Sequence:CCGGCCATGTCTAGTGGCCTAGAATCTCGAGATTCTAGGCCACTAGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-754s1c1
Sequence:CCGGCGTCAGTTGTTGGATCGAAATCTCGAGATTTCGATCCAACAACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-2440s1c1
Sequence:CCGGCGGAAGCAAGTGCTAAGGATACTCGAGTATCCTTAGCACTTGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009125.1-3143s1c1
Sequence:CCGGCAGTCCTGTCATACAAGGTAACTCGAGTTACCTTGTATGACAGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)