EMAIL THIS PAGE TO A FRIEND

ATXN3

ataxin 3

112 Gene Product Result for
Synonyms: AT3 ATX3 JOS MJD MJD1 SCA3
Gene ID:
Human(4287) Summary: Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 13-36 to 68-79 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2009]
Mouse(110616) ataxin 3
Rat(60331) ataxin 3
sheep(100171397) ataxin 3
cow(790880) ataxin 3
dog(480229) ataxin 3
chicken(378424) ataxin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004993 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024631 Rosetta Predictions human pricing
NM_001127696 Rosetta Predictions human pricing
NM_001127697 Rosetta Predictions human pricing
NM_004993 Rosetta Predictions human pricing
NM_030660 Rosetta Predictions human pricing
NM_021702 Rosetta Predictions rat pricing
NM_029705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043300 predicted 551
2 SASI_Hs01_00043301 predicted 613
3 SASI_Hs01_00043302 predicted 788
4 SASI_Hs01_00043303 predicted 677
5 SASI_Hs01_00043304 predicted 465
6 SASI_Hs01_00043305 predicted 711
7 SASI_Hs01_00043306 predicted 404
8 SASI_Hs01_00043307 predicted 750
9 SASI_Hs01_00043308 predicted 71
10 SASI_Hs01_00043309 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330164 predicted 511
2 SASI_Hs02_00330165 predicted 215
3 SASI_Hs02_00330166 predicted 447
4 SASI_Hs02_00330167 predicted 602
5 SASI_Hs02_00330168 predicted 285
6 SASI_Hs02_00330169 predicted 496
7 SASI_Hs02_00330170 predicted 663
8 SASI_Hs02_00330171 predicted 327
9 SASI_Hs02_00330172 predicted 285
10 SASI_Hs02_00330173 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330174 predicted 356
2 SASI_Hs02_00330175 predicted 1141
3 SASI_Hs02_00330176 predicted 298
4 SASI_Hs02_00330177 predicted 1140
5 SASI_Hs02_00330178 predicted 443
6 SASI_Hs02_00330179 predicted 340
7 SASI_Hs02_00330180 predicted 507
8 SASI_Hs02_00330181 predicted 1227
9 SASI_Hs02_00330182 predicted 1091
10 SASI_Hs02_00330183 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338718 predicted 558
2 SASI_Hs02_00338719 predicted 219
3 SASI_Hs02_00338720 predicted 493
4 SASI_Hs01_00126575 predicted 644
5 SASI_Hs02_00338721 predicted 328
6 SASI_Hs02_00338722 predicted 541
7 SASI_Hs01_00126576 predicted 706
8 SASI_Hs02_00338723 predicted 372
9 SASI_Hs02_00338724 predicted 334
10 SASI_Hs02_00338725 predicted 221
11 SASI_Hs01_00126574 predicted 1620
12 SASI_Hs01_00126577 predicted 1214
13 SASI_Hs01_00126578 predicted 1572
14 SASI_Hs01_00126579 predicted 1572
15 SASI_Hs01_00126580 predicted 1608
16 SASI_Hs01_00126581 predicted 1600
17 SASI_Hs01_00126582 predicted 1464
18 SASI_Hs01_00126583 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358236 predicted 388
2 SASI_Hs02_00358237 predicted 1174
3 SASI_Hs02_00358238 predicted 330
4 SASI_Hs01_00151503 predicted 482
5 SASI_Hs01_00151504 predicted 547
6 SASI_Hs02_00358239 predicted 1185
7 SASI_Hs02_00358240 predicted 212
8 SASI_Hs02_00358241 predicted 1259
9 SASI_Hs02_00358242 predicted 1128
10 SASI_Hs02_00358243 predicted 1052
11 SASI_Hs01_00151502 predicted 1461
12 SASI_Hs01_00151505 predicted 1052
13 SASI_Hs01_00151506 predicted 1408
14 SASI_Hs01_00151507 predicted 1405
15 SASI_Hs01_00151508 predicted 1443
16 SASI_Hs01_00151509 predicted 1429
17 SASI_Hs01_00151510 predicted 1293
18 SASI_Hs01_00151511 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106712 predicted 435
2 SASI_Rn02_00262749 predicted 1200
3 SASI_Rn01_00106713 predicted 850
4 SASI_Rn01_00106715 predicted 421
5 SASI_Rn01_00106716 predicted 867
6 SASI_Rn01_00106717 predicted 490
7 SASI_Rn01_00106718 predicted 1134
8 SASI_Rn01_00106719 predicted 329
9 SASI_Rn01_00106720 predicted 715
10 SASI_Rn02_00262750 predicted 1108
11 SASI_Rn01_00106711 predicted 373
12 SASI_Rn01_00106714 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181308 predicted 344
2 SASI_Mm01_00181309 predicted 348
3 SASI_Mm01_00181310 predicted 424
4 SASI_Mm01_00181311 predicted 461
5 SASI_Mm01_00181312 predicted 773
6 SASI_Mm01_00181313 predicted 941
7 SASI_Mm02_00335762 predicted 470
8 SASI_Mm01_00181314 predicted 442
9 SASI_Mm01_00181315 predicted 408
10 SASI_Mm01_00181316 predicted 755
11 SASI_Mm01_00181307 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004993
VALIDATED
ATXN3 MISSION shRNA Bacterial Glycerol Stock
ataxin 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-255s21c1
Sequence:CCGGACAGCAGCCTTCTGGAAATATCTCGAGATATTTCCAGAAGGCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-414s21c1
Sequence:CCGGTTATAAGGAACACTGGTTTACCTCGAGGTAAACCAGTGTTCCTTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-1093s21c1
Sequence:CCGGGCAGCTGTGACCATGTCTTTACTCGAGTAAAGACATGGTCACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-874s21c1
Sequence:CCGGACACAGACATCAGGTACAAATCTCGAGATTTGTACCTGATGTCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-478s21c1
Sequence:CCGGTTGACGGGTCCAGAATTAATACTCGAGTATTAATTCTGGACCCGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-594s21c1
Sequence:CCGGCCAACTCCTGCAGATGATTAGCTCGAGCTAATCATCTGCAGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-373s21c1
Sequence:CCGGCTCAGGATCGATCCTATAAATCTCGAGATTTATAGGATCGATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-917s21c1
Sequence:CCGGAGAGACGAGAAGCCTACTTTGCTCGAGCAAAGTAGGCTTCTCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-531s21c1
Sequence:CCGGATTACAACAGGAAGGTTATTCCTCGAGGAATAACCTTCCTGTTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004993.5-1428s21c1
Sequence:CCGGATGTCTAAAGTTAGGGCATTTCTCGAGAAATGCCCTAACTTTAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004993.2-807s1c1
Sequence:CCGGGCAGGGCTATTCAGCTAAGTACTCGAGTACTTAGCTGAATAGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004993.2-1294s1c1
Sequence:CCGGCGTCGGTTGTAGGACTAAATACTCGAGTATTTAGTCCTACAACCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004993.2-689s1c1
Sequence:CCGGCGAGTGTTAGAAGCAAATGATCTCGAGATCATTTGCTTCTAACACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004993.2-99s1c1
Sequence:CCGGGTGCTCAACATTGCCTGAATACTCGAGTATTCAGGCAATGTTGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004993.2-767s1c1
Sequence:CCGGCGCCAAGAAATTGACATGGAACTCGAGTTCCATGTCAATTTCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004993
VALIDATED
ATXN3 MISSION shRNA shRNA Plasmid DNA
ataxin 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-255s21c1
Sequence:CCGGACAGCAGCCTTCTGGAAATATCTCGAGATATTTCCAGAAGGCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-414s21c1
Sequence:CCGGTTATAAGGAACACTGGTTTACCTCGAGGTAAACCAGTGTTCCTTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-1093s21c1
Sequence:CCGGGCAGCTGTGACCATGTCTTTACTCGAGTAAAGACATGGTCACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-874s21c1
Sequence:CCGGACACAGACATCAGGTACAAATCTCGAGATTTGTACCTGATGTCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-478s21c1
Sequence:CCGGTTGACGGGTCCAGAATTAATACTCGAGTATTAATTCTGGACCCGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-594s21c1
Sequence:CCGGCCAACTCCTGCAGATGATTAGCTCGAGCTAATCATCTGCAGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-373s21c1
Sequence:CCGGCTCAGGATCGATCCTATAAATCTCGAGATTTATAGGATCGATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-917s21c1
Sequence:CCGGAGAGACGAGAAGCCTACTTTGCTCGAGCAAAGTAGGCTTCTCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-531s21c1
Sequence:CCGGATTACAACAGGAAGGTTATTCCTCGAGGAATAACCTTCCTGTTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004993.5-1428s21c1
Sequence:CCGGATGTCTAAAGTTAGGGCATTTCTCGAGAAATGCCCTAACTTTAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004993.2-807s1c1
Sequence:CCGGGCAGGGCTATTCAGCTAAGTACTCGAGTACTTAGCTGAATAGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004993.2-1294s1c1
Sequence:CCGGCGTCGGTTGTAGGACTAAATACTCGAGTATTTAGTCCTACAACCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004993.2-689s1c1
Sequence:CCGGCGAGTGTTAGAAGCAAATGATCTCGAGATCATTTGCTTCTAACACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004993.2-99s1c1
Sequence:CCGGGTGCTCAACATTGCCTGAATACTCGAGTATTCAGGCAATGTTGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004993.2-767s1c1
Sequence:CCGGCGCCAAGAAATTGACATGGAACTCGAGTTCCATGTCAATTTCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004993
VALIDATED
ATXN3 MISSION shRNA Lentiviral Transduction Particles
ataxin 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-255s21c1
Sequence:CCGGACAGCAGCCTTCTGGAAATATCTCGAGATATTTCCAGAAGGCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-414s21c1
Sequence:CCGGTTATAAGGAACACTGGTTTACCTCGAGGTAAACCAGTGTTCCTTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-1093s21c1
Sequence:CCGGGCAGCTGTGACCATGTCTTTACTCGAGTAAAGACATGGTCACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-874s21c1
Sequence:CCGGACACAGACATCAGGTACAAATCTCGAGATTTGTACCTGATGTCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-478s21c1
Sequence:CCGGTTGACGGGTCCAGAATTAATACTCGAGTATTAATTCTGGACCCGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-594s21c1
Sequence:CCGGCCAACTCCTGCAGATGATTAGCTCGAGCTAATCATCTGCAGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-373s21c1
Sequence:CCGGCTCAGGATCGATCCTATAAATCTCGAGATTTATAGGATCGATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-917s21c1
Sequence:CCGGAGAGACGAGAAGCCTACTTTGCTCGAGCAAAGTAGGCTTCTCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004993.5-531s21c1
Sequence:CCGGATTACAACAGGAAGGTTATTCCTCGAGGAATAACCTTCCTGTTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004993.5-1428s21c1
Sequence:CCGGATGTCTAAAGTTAGGGCATTTCTCGAGAAATGCCCTAACTTTAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004993.2-807s1c1
Sequence:CCGGGCAGGGCTATTCAGCTAAGTACTCGAGTACTTAGCTGAATAGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004993.2-1294s1c1
Sequence:CCGGCGTCGGTTGTAGGACTAAATACTCGAGTATTTAGTCCTACAACCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004993.2-689s1c1
Sequence:CCGGCGAGTGTTAGAAGCAAATGATCTCGAGATCATTTGCTTCTAACACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004993.2-99s1c1
Sequence:CCGGGTGCTCAACATTGCCTGAATACTCGAGTATTCAGGCAATGTTGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004993.2-767s1c1
Sequence:CCGGCGCCAAGAAATTGACATGGAACTCGAGTTCCATGTCAATTTCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029705
ATXN3 MISSION shRNA Bacterial Glycerol Stock
ataxin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029705.1-2947s1c1
Sequence:CCGGGCCAATATACACTTCAGCTTTCTCGAGAAAGCTGAAGTGTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-329s1c1
Sequence:CCGGGCTCAGAATTGATCCTATAAACTCGAGTTTATAGGATCAATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-468s1c1
Sequence:CCGGCTCGCACTATTCTTGGCTCAACTCGAGTTGAGCCAAGAATAGTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-470s1c1
Sequence:CCGGCGCACTATTCTTGGCTCAATTCTCGAGAATTGAGCCAAGAATAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-58s1c1
Sequence:CCGGGCTCACTTTGTGCTCAGCATTCTCGAGAATGCTGAGCACAAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029705
ATXN3 MISSION shRNA shRNA Plasmid DNA
ataxin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029705.1-2947s1c1
Sequence:CCGGGCCAATATACACTTCAGCTTTCTCGAGAAAGCTGAAGTGTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-329s1c1
Sequence:CCGGGCTCAGAATTGATCCTATAAACTCGAGTTTATAGGATCAATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-468s1c1
Sequence:CCGGCTCGCACTATTCTTGGCTCAACTCGAGTTGAGCCAAGAATAGTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-470s1c1
Sequence:CCGGCGCACTATTCTTGGCTCAATTCTCGAGAATTGAGCCAAGAATAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-58s1c1
Sequence:CCGGGCTCACTTTGTGCTCAGCATTCTCGAGAATGCTGAGCACAAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029705
ATXN3 MISSION shRNA Lentiviral Transduction Particles
ataxin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029705.1-2947s1c1
Sequence:CCGGGCCAATATACACTTCAGCTTTCTCGAGAAAGCTGAAGTGTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-329s1c1
Sequence:CCGGGCTCAGAATTGATCCTATAAACTCGAGTTTATAGGATCAATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-468s1c1
Sequence:CCGGCTCGCACTATTCTTGGCTCAACTCGAGTTGAGCCAAGAATAGTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-470s1c1
Sequence:CCGGCGCACTATTCTTGGCTCAATTCTCGAGAATTGAGCCAAGAATAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029705.1-58s1c1
Sequence:CCGGGCTCACTTTGTGCTCAGCATTCTCGAGAATGCTGAGCACAAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks