EMAIL THIS PAGE TO A FRIEND

ATXN7

ataxin 7

95 Gene Product Result for
Synonyms: ADCAII OPCA3 SCA7
UniProtKB ID: O15265, B4E207, E9PHP9, O75328, O75329, Q9Y6P8
Gene ID:
Human(6314) Summary: The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 38-130 CAG repeats (near the N-terminus), compared to 7-17 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Mouse(246103) ataxin 7
Rat(361015) ataxin 7
chicken(416078) ataxin 7
Horse(100055963) ataxin 7
cow(536833) ataxin 7
dog(484701) ataxin 7
sheep(101106632) ataxin 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000333 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000333 Rosetta Predictions human pricing
NM_001128149 Rosetta Predictions human pricing
XM_001069337 Rosetta Predictions rat pricing
XM_341290 Rosetta Predictions rat pricing
NM_139227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139114 predicted 2954
2 SASI_Hs01_00139115 predicted 1030
3 SASI_Hs01_00139116 predicted 1630
4 SASI_Hs01_00139117 predicted 2950
5 SASI_Hs01_00139118 predicted 1698
6 SASI_Hs01_00139119 predicted 3245
7 SASI_Hs01_00139120 predicted 2273
8 SASI_Hs01_00139121 predicted 1515
9 SASI_Hs01_00139122 predicted 1872
10 SASI_Hs02_00302350 predicted 2205
11 SASI_Hs01_00139123 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330596 predicted 2952
2 SASI_Hs02_00330597 predicted 1026
3 SASI_Hs02_00330598 predicted 1630
4 SASI_Hs02_00330599 predicted 2955
5 SASI_Hs02_00330600 predicted 1701
6 SASI_Hs02_00330601 predicted 3317
7 SASI_Hs02_00330602 predicted 2279
8 SASI_Hs02_00330603 predicted 3206
9 SASI_Hs02_00330604 predicted 1517
10 SASI_Hs02_00330605 predicted 1868
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327671 predicted 2512
2 SASI_Rn02_00327672 predicted 2304
3 SASI_Rn02_00327673 predicted 1110
4 SASI_Rn02_00327674 predicted 897
5 SASI_Rn02_00327675 predicted 1531
6 SASI_Rn02_00327676 predicted 2215
7 SASI_Rn02_00327677 predicted 1153
8 SASI_Rn02_00327678 predicted 1541
9 SASI_Rn02_00327679 predicted 715
10 SASI_Rn02_00327680 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392678 predicted 739
2 SASI_Rn02_00392679 predicted 2944
3 SASI_Rn02_00392680 predicted 880
4 SASI_Rn02_00392681 predicted 2739
5 SASI_Rn02_00392682 predicted 2651
6 SASI_Rn02_00392683 predicted 1981
7 SASI_Rn02_00392684 predicted 728
8 SASI_Rn02_00392685 predicted 2313
9 SASI_Rn02_00392686 predicted 861
10 SASI_Rn02_00392687 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041104 predicted 1094
2 SASI_Mm01_00041105 predicted 1379
3 SASI_Mm01_00041106 predicted 1783
4 SASI_Mm01_00041108 predicted 2622
5 SASI_Mm01_00041109 predicted 1982
6 SASI_Mm02_00339947 predicted 646
7 SASI_Mm02_00339948 predicted 1858
8 SASI_Mm01_00041111 predicted 2771
9 SASI_Mm01_00041112 predicted 1809
10 SASI_Mm02_00339949 predicted 2757
11 SASI_Mm01_00041107 predicted 1874
12 SASI_Mm01_00041110 predicted 564
13 SASI_Mm01_00041113 predicted 1079
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000333
VALIDATED
ATXN7 MISSION shRNA Bacterial Glycerol Stock
ataxin 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000333.3-940s21c1
Sequence:CCGGTCGGGAAGACATGCCAATATTCTCGAGAATATTGGCATGTCTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000333.3-3410s21c1
Sequence:CCGGTCTAGCAGTGAGTACTCATAACTCGAGTTATGAGTACTCACTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000333.3-2823s21c1
Sequence:CCGGGCCTCAACTGTGTGACGAATACTCGAGTATTCGTCACACAGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000333.3-2279s21c1
Sequence:CCGGCGTATTCCTCACCGGACAAACCTCGAGGTTTGTCCGGTGAGGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000333.3-2135s21c1
Sequence:CCGGCAGATAGGAAGAGGCTATTACCTCGAGGTAATAGCCTCTTCCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000333.1-1037s1c1
Sequence:CCGGCGCAGGCATTTCAATCACATTCTCGAGAATGTGATTGAAATGCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000333.1-2831s1c1
Sequence:CCGGGCCTCAACTGTGTGACGAATACTCGAGTATTCGTCACACAGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000333.1-2142s1c1
Sequence:CCGGGCAGATAGGAAGAGGCTATTACTCGAGTAATAGCCTCTTCCTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000333.1-1396s1c1
Sequence:CCGGCCTGCTACTGTGAGTTCCTTACTCGAGTAAGGAACTCACAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000333.1-3504s1c1
Sequence:CCGGGCTACCAATCTGTGAGAAGTTCTCGAGAACTTCTCACAGATTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000333
VALIDATED
ATXN7 MISSION shRNA shRNA Plasmid DNA
ataxin 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000333.3-940s21c1
Sequence:CCGGTCGGGAAGACATGCCAATATTCTCGAGAATATTGGCATGTCTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000333.3-3410s21c1
Sequence:CCGGTCTAGCAGTGAGTACTCATAACTCGAGTTATGAGTACTCACTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000333.3-2823s21c1
Sequence:CCGGGCCTCAACTGTGTGACGAATACTCGAGTATTCGTCACACAGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000333.3-2279s21c1
Sequence:CCGGCGTATTCCTCACCGGACAAACCTCGAGGTTTGTCCGGTGAGGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000333.3-2135s21c1
Sequence:CCGGCAGATAGGAAGAGGCTATTACCTCGAGGTAATAGCCTCTTCCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000333.1-1037s1c1
Sequence:CCGGCGCAGGCATTTCAATCACATTCTCGAGAATGTGATTGAAATGCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000333.1-2831s1c1
Sequence:CCGGGCCTCAACTGTGTGACGAATACTCGAGTATTCGTCACACAGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000333.1-2142s1c1
Sequence:CCGGGCAGATAGGAAGAGGCTATTACTCGAGTAATAGCCTCTTCCTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000333.1-1396s1c1
Sequence:CCGGCCTGCTACTGTGAGTTCCTTACTCGAGTAAGGAACTCACAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000333.1-3504s1c1
Sequence:CCGGGCTACCAATCTGTGAGAAGTTCTCGAGAACTTCTCACAGATTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000333
VALIDATED
ATXN7 MISSION shRNA Lentiviral Transduction Particles
ataxin 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000333.3-940s21c1
Sequence:CCGGTCGGGAAGACATGCCAATATTCTCGAGAATATTGGCATGTCTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000333.3-3410s21c1
Sequence:CCGGTCTAGCAGTGAGTACTCATAACTCGAGTTATGAGTACTCACTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000333.3-2823s21c1
Sequence:CCGGGCCTCAACTGTGTGACGAATACTCGAGTATTCGTCACACAGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000333.3-2279s21c1
Sequence:CCGGCGTATTCCTCACCGGACAAACCTCGAGGTTTGTCCGGTGAGGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000333.3-2135s21c1
Sequence:CCGGCAGATAGGAAGAGGCTATTACCTCGAGGTAATAGCCTCTTCCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000333.1-1037s1c1
Sequence:CCGGCGCAGGCATTTCAATCACATTCTCGAGAATGTGATTGAAATGCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000333.1-2831s1c1
Sequence:CCGGGCCTCAACTGTGTGACGAATACTCGAGTATTCGTCACACAGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000333.1-2142s1c1
Sequence:CCGGGCAGATAGGAAGAGGCTATTACTCGAGTAATAGCCTCTTCCTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000333.1-1396s1c1
Sequence:CCGGCCTGCTACTGTGAGTTCCTTACTCGAGTAAGGAACTCACAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000333.1-3504s1c1
Sequence:CCGGGCTACCAATCTGTGAGAAGTTCTCGAGAACTTCTCACAGATTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139227
VALIDATED
ATXN7 MISSION shRNA Bacterial Glycerol Stock
ataxin 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-3135s1c1
Sequence:CCGGCGTGAGAAGTTTGTGTTTGTACTCGAGTACAAACACAAACTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139227.2-2482s1c1
Sequence:CCGGGCCTCAACTGTGTGACAAATACTCGAGTATTTGTCACACAGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-714s1c1
Sequence:CCGGGCATTTCAATCTCACTATGAACTCGAGTTCATAGTGAGATTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-1790s1c1
Sequence:CCGGGCAGATTGGAAGAGGTTATTACTCGAGTAATAACCTCTTCCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-710s1c1
Sequence:CCGGGCAGGCATTTCAATCTCACTACTCGAGTAGTGAGATTGAAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139227
VALIDATED
ATXN7 MISSION shRNA shRNA Plasmid DNA
ataxin 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-3135s1c1
Sequence:CCGGCGTGAGAAGTTTGTGTTTGTACTCGAGTACAAACACAAACTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139227.2-2482s1c1
Sequence:CCGGGCCTCAACTGTGTGACAAATACTCGAGTATTTGTCACACAGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-714s1c1
Sequence:CCGGGCATTTCAATCTCACTATGAACTCGAGTTCATAGTGAGATTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-1790s1c1
Sequence:CCGGGCAGATTGGAAGAGGTTATTACTCGAGTAATAACCTCTTCCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-710s1c1
Sequence:CCGGGCAGGCATTTCAATCTCACTACTCGAGTAGTGAGATTGAAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139227
VALIDATED
ATXN7 MISSION shRNA Lentiviral Transduction Particles
ataxin 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-3135s1c1
Sequence:CCGGCGTGAGAAGTTTGTGTTTGTACTCGAGTACAAACACAAACTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139227.2-2482s1c1
Sequence:CCGGGCCTCAACTGTGTGACAAATACTCGAGTATTTGTCACACAGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-714s1c1
Sequence:CCGGGCATTTCAATCTCACTATGAACTCGAGTTCATAGTGAGATTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-1790s1c1
Sequence:CCGGGCAGATTGGAAGAGGTTATTACTCGAGTAATAACCTCTTCCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139227.2-710s1c1
Sequence:CCGGGCAGGCATTTCAATCTCACTACTCGAGTAGTGAGATTGAAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks