EMAIL THIS PAGE TO A FRIEND

ATXN7L1

ataxin 7-like 1

266 Gene Product Result for
Synonyms: ATXN7L4
UniProtKB ID: Q9ULK2, B4DTS1, Q8N2T0
Gene ID:
Mouse(380753) ataxin 7-like 1
Rat(314033) ataxin 7-like 1
naked mole-rat(101710740) ataxin 7-like 1
Domestic Rabbit(100343131) ataxin 7-like 1
chicken(427847) ataxin 7-like 1
cow(534448) ataxin 7-like 1
Horse(100059050) ataxin 7-like 1
domestic cat(101082553) ataxin 7-like 1
dog(475892) ataxin 7-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001033436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152749 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020725 Rosetta Predictions human pricing
NM_152749 Rosetta Predictions human pricing
XM_001073904 Rosetta Predictions rat pricing
XM_234056 Rosetta Predictions rat pricing
NM_001033436 Rosetta Predictions mouse pricing
NM_028139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353778 predicted 1451
2 SASI_Hs02_00353779 predicted 1468
3 SASI_Hs02_00353780 predicted 279
4 SASI_Hs02_00353781 predicted 909
5 SASI_Hs02_00353782 predicted 854
6 SASI_Hs02_00353783 predicted 826
7 SASI_Hs02_00353784 predicted 1097
8 SASI_Hs02_00353785 predicted 819
9 SASI_Hs02_00353786 predicted 1455
10 SASI_Hs02_00353787 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366668 predicted 196
2 SASI_Hs01_00054842 predicted 277
3 SASI_Hs01_00054843 predicted 244
4 SASI_Hs01_00054844 predicted 261
5 SASI_Hs02_00366669 predicted 193
6 SASI_Hs01_00054846 predicted 307
7 SASI_Hs01_00054847 predicted 251
8 SASI_Hs01_00054849 predicted 274
9 SASI_Hs01_00054850 predicted 301
10 SASI_Hs01_00054851 predicted 306
11 SASI_Hs01_00054845 predicted 251
12 SASI_Hs01_00054848 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344314 predicted 930
2 SASI_Rn02_00344315 predicted 940
3 SASI_Rn02_00344316 predicted 1484
4 SASI_Rn02_00344317 predicted 391
5 SASI_Rn02_00344318 predicted 956
6 SASI_Rn02_00344319 predicted 1274
7 SASI_Rn02_00344320 predicted 425
8 SASI_Rn02_00344321 predicted 989
9 SASI_Rn02_00344322 predicted 2085
10 SASI_Rn02_00344323 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388224 predicted 2085
2 SASI_Rn02_00388225 predicted 2050
3 SASI_Rn02_00388226 predicted 2246
4 SASI_Rn02_00388227 predicted 2310
5 SASI_Rn02_00388228 predicted 2301
6 SASI_Rn02_00388229 predicted 2032
7 SASI_Rn02_00388230 predicted 2060
8 SASI_Rn02_00388231 predicted 2087
9 SASI_Rn02_00388232 predicted 2037
10 SASI_Rn02_00388233 predicted 2138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288749 predicted 878
2 SASI_Mm01_00188530 predicted 1466
3 SASI_Mm02_00288750 predicted 297
4 SASI_Mm02_00288751 predicted 879
5 SASI_Mm01_00188533 predicted 923
6 SASI_Mm01_00188534 predicted 1485
7 SASI_Mm02_00288752 predicted 300
8 SASI_Mm01_00188535 predicted 1800
9 SASI_Mm02_00288753 predicted 957
10 SASI_Mm02_00288754 predicted 1515
11 SASI_Mm01_00188529 predicted 2088
12 SASI_Mm01_00188531 predicted 1183
13 SASI_Mm01_00188532 predicted 1620
14 SASI_Mm01_00188536 predicted 2031
15 SASI_Mm01_00188537 predicted 554
16 SASI_Mm01_00188538 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130892 predicted 294
2 SASI_Mm01_00130893 predicted 407
3 SASI_Mm01_00130898 predicted 304
4 SASI_Mm02_00333407 predicted 913
5 SASI_Mm02_00333408 predicted 106
6 SASI_Mm02_00333409 predicted 105
7 SASI_Mm01_00130894 predicted 184
8 SASI_Mm01_00130895 predicted 895
9 SASI_Mm01_00130896 predicted 603
10 SASI_Mm01_00130897 predicted 607
11 SASI_Mm01_00130890 predicted 402
12 SASI_Mm01_00130891 predicted 391
13 SASI_Mm01_00130899 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028139
VALIDATED
ATXN7L1 MISSION shRNA Bacterial Glycerol Stock
ataxin 7-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028139.1-1052s1c1
Sequence:CCGGCCCTCCCTAACACAATGGTTTCTCGAGAAACCATTGTGTTAGGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028139.1-179s1c1
Sequence:CCGGAGGGAGGTTATGAGGCTTAATCTCGAGATTAAGCCTCATAACCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028139.1-131s1c1
Sequence:CCGGTCCGACAATGTAGATTTAGAACTCGAGTTCTAAATCTACATTGTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028139.1-230s1c1
Sequence:CCGGCCAGCACATGATGACTTCTATCTCGAGATAGAAGTCATCATGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028139.1-118s1c1
Sequence:CCGGCAAATTACACTGCTCCGACAACTCGAGTTGTCGGAGCAGTGTAATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028139
VALIDATED
ATXN7L1 MISSION shRNA shRNA Plasmid DNA
ataxin 7-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028139.1-1052s1c1
Sequence:CCGGCCCTCCCTAACACAATGGTTTCTCGAGAAACCATTGTGTTAGGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028139.1-179s1c1
Sequence:CCGGAGGGAGGTTATGAGGCTTAATCTCGAGATTAAGCCTCATAACCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028139.1-131s1c1
Sequence:CCGGTCCGACAATGTAGATTTAGAACTCGAGTTCTAAATCTACATTGTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028139.1-230s1c1
Sequence:CCGGCCAGCACATGATGACTTCTATCTCGAGATAGAAGTCATCATGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028139.1-118s1c1
Sequence:CCGGCAAATTACACTGCTCCGACAACTCGAGTTGTCGGAGCAGTGTAATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028139
VALIDATED
ATXN7L1 MISSION shRNA Lentiviral Transduction Particles
ataxin 7-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028139.1-1052s1c1
Sequence:CCGGCCCTCCCTAACACAATGGTTTCTCGAGAAACCATTGTGTTAGGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028139.1-179s1c1
Sequence:CCGGAGGGAGGTTATGAGGCTTAATCTCGAGATTAAGCCTCATAACCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028139.1-131s1c1
Sequence:CCGGTCCGACAATGTAGATTTAGAACTCGAGTTCTAAATCTACATTGTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028139.1-230s1c1
Sequence:CCGGCCAGCACATGATGACTTCTATCTCGAGATAGAAGTCATCATGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028139.1-118s1c1
Sequence:CCGGCAAATTACACTGCTCCGACAACTCGAGTTGTCGGAGCAGTGTAATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033436
VALIDATED
ATXN7L1 MISSION shRNA Bacterial Glycerol Stock
ataxin 7-like 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.1-1055s1c1
Sequence:CCGGCGAGAAGTTAGACTGTCAGTTCTCGAGAACTGACAGTCTAACTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.1-1134s1c1
Sequence:CCGGCGAGGATACTATGTGTTTGATCTCGAGATCAAACACATAGTATCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.1-1616s1c1
Sequence:CCGGCGACGAATCTCCAAGTAACAACTCGAGTTGTTACTTGGAGATTCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033436.2-2678s1c1
Sequence:CCGGCCTTTAGTCCTCACAACAAACCTCGAGGTTTGTTGTGAGGACTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.2-788s1c1
Sequence:CCGGCTTCACCAGAGAAGATCTTAACTCGAGTTAAGATCTTCTCTGGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.2-1471s1c1
Sequence:CCGGGATAGAAGGTGGGATCGATTTCTCGAGAAATCGATCCCACCTTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-789s21c1
Sequence:CCGGTTCACCAGAGAAGATCTTAAACTCGAGTTTAAGATCTTCTCTGGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033436.2-267s21c1
Sequence:CCGGGGAGGTTATGAGGCTTAATAACTCGAGTTATTAAGCCTCATAACCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033436.2-2652s21c1
Sequence:CCGGTGCTGAGCACTTTACAGTAATCTCGAGATTACTGTAAAGTGCTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-1472s21c1
Sequence:CCGGATAGAAGGTGGGATCGATTTCCTCGAGGAAATCGATCCCACCTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-1233s21c1
Sequence:CCGGATCGTCTGCAAACAGCATAAGCTCGAGCTTATGCTGTTTGCAGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-520s21c1
Sequence:CCGGAGCACCTCAAAGCCATTTAAACTCGAGTTTAAATGGCTTTGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033436
VALIDATED
ATXN7L1 MISSION shRNA shRNA Plasmid DNA
ataxin 7-like 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.1-1055s1c1
Sequence:CCGGCGAGAAGTTAGACTGTCAGTTCTCGAGAACTGACAGTCTAACTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.1-1134s1c1
Sequence:CCGGCGAGGATACTATGTGTTTGATCTCGAGATCAAACACATAGTATCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.1-1616s1c1
Sequence:CCGGCGACGAATCTCCAAGTAACAACTCGAGTTGTTACTTGGAGATTCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033436.2-2678s1c1
Sequence:CCGGCCTTTAGTCCTCACAACAAACCTCGAGGTTTGTTGTGAGGACTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.2-788s1c1
Sequence:CCGGCTTCACCAGAGAAGATCTTAACTCGAGTTAAGATCTTCTCTGGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.2-1471s1c1
Sequence:CCGGGATAGAAGGTGGGATCGATTTCTCGAGAAATCGATCCCACCTTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-789s21c1
Sequence:CCGGTTCACCAGAGAAGATCTTAAACTCGAGTTTAAGATCTTCTCTGGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033436.2-267s21c1
Sequence:CCGGGGAGGTTATGAGGCTTAATAACTCGAGTTATTAAGCCTCATAACCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033436.2-2652s21c1
Sequence:CCGGTGCTGAGCACTTTACAGTAATCTCGAGATTACTGTAAAGTGCTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-1472s21c1
Sequence:CCGGATAGAAGGTGGGATCGATTTCCTCGAGGAAATCGATCCCACCTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-1233s21c1
Sequence:CCGGATCGTCTGCAAACAGCATAAGCTCGAGCTTATGCTGTTTGCAGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-520s21c1
Sequence:CCGGAGCACCTCAAAGCCATTTAAACTCGAGTTTAAATGGCTTTGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033436
VALIDATED
ATXN7L1 MISSION shRNA Lentiviral Transduction Particles
ataxin 7-like 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.1-1055s1c1
Sequence:CCGGCGAGAAGTTAGACTGTCAGTTCTCGAGAACTGACAGTCTAACTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.1-1134s1c1
Sequence:CCGGCGAGGATACTATGTGTTTGATCTCGAGATCAAACACATAGTATCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.1-1616s1c1
Sequence:CCGGCGACGAATCTCCAAGTAACAACTCGAGTTGTTACTTGGAGATTCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033436.2-2678s1c1
Sequence:CCGGCCTTTAGTCCTCACAACAAACCTCGAGGTTTGTTGTGAGGACTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.2-788s1c1
Sequence:CCGGCTTCACCAGAGAAGATCTTAACTCGAGTTAAGATCTTCTCTGGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033436.2-1471s1c1
Sequence:CCGGGATAGAAGGTGGGATCGATTTCTCGAGAAATCGATCCCACCTTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-789s21c1
Sequence:CCGGTTCACCAGAGAAGATCTTAAACTCGAGTTTAAGATCTTCTCTGGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033436.2-267s21c1
Sequence:CCGGGGAGGTTATGAGGCTTAATAACTCGAGTTATTAAGCCTCATAACCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033436.2-2652s21c1
Sequence:CCGGTGCTGAGCACTTTACAGTAATCTCGAGATTACTGTAAAGTGCTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-1472s21c1
Sequence:CCGGATAGAAGGTGGGATCGATTTCCTCGAGGAAATCGATCCCACCTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-1233s21c1
Sequence:CCGGATCGTCTGCAAACAGCATAAGCTCGAGCTTATGCTGTTTGCAGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033436.2-520s21c1
Sequence:CCGGAGCACCTCAAAGCCATTTAAACTCGAGTTTAAATGGCTTTGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152749
ATXN7L1 MISSION shRNA Bacterial Glycerol Stock
ataxin 7-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152749.2-438s1c1
Sequence:CCGGCCAAGCCATAGAGAAGCATCACTCGAGTGATGCTTCTCTATGGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152749.2-90s1c1
Sequence:CCGGGCAACAAGAAGGAAGAGCAATCTCGAGATTGCTCTTCCTTCTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152749.2-387s1c1
Sequence:CCGGGCAAGACAACAGGAGAAATGACTCGAGTCATTTCTCCTGTTGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152749.2-383s1c1
Sequence:CCGGGAAAGCAAGACAACAGGAGAACTCGAGTTCTCCTGTTGTCTTGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152749.2-931s1c1
Sequence:CCGGGCTCCCTTTCATTGTCTATATCTCGAGATATAGACAATGAAAGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152749.2-186s1c1
Sequence:CCGGCAAATTACACTGCTCCGACAACTCGAGTTGTCGGAGCAGTGTAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152749.2-246s1c1
Sequence:CCGGCAGGGAGGTTATGAGGCTTAACTCGAGTTAAGCCTCATAACCTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152749.2-476s1c1
Sequence:CCGGCGCAGAAGAGACGTACAACTTCTCGAGAAGTTGTACGTCTCTTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152749.3-279s21c1
Sequence:CCGGTATGCACTTATTTGGCCATTACTCGAGTAATGGCCAAATAAGTGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152749.3-309s21c1
Sequence:CCGGTGACGACTTCTATCTCGTAGTCTCGAGACTACGAGATAGAAGTCGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152749
ATXN7L1 MISSION shRNA shRNA Plasmid DNA
ataxin 7-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152749.2-438s1c1
Sequence:CCGGCCAAGCCATAGAGAAGCATCACTCGAGTGATGCTTCTCTATGGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152749.2-90s1c1
Sequence:CCGGGCAACAAGAAGGAAGAGCAATCTCGAGATTGCTCTTCCTTCTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152749.2-387s1c1
Sequence:CCGGGCAAGACAACAGGAGAAATGACTCGAGTCATTTCTCCTGTTGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152749.2-383s1c1
Sequence:CCGGGAAAGCAAGACAACAGGAGAACTCGAGTTCTCCTGTTGTCTTGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152749.2-931s1c1
Sequence:CCGGGCTCCCTTTCATTGTCTATATCTCGAGATATAGACAATGAAAGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152749.2-186s1c1
Sequence:CCGGCAAATTACACTGCTCCGACAACTCGAGTTGTCGGAGCAGTGTAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152749.2-246s1c1
Sequence:CCGGCAGGGAGGTTATGAGGCTTAACTCGAGTTAAGCCTCATAACCTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152749.2-476s1c1
Sequence:CCGGCGCAGAAGAGACGTACAACTTCTCGAGAAGTTGTACGTCTCTTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152749.3-279s21c1
Sequence:CCGGTATGCACTTATTTGGCCATTACTCGAGTAATGGCCAAATAAGTGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152749.3-309s21c1
Sequence:CCGGTGACGACTTCTATCTCGTAGTCTCGAGACTACGAGATAGAAGTCGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152749
ATXN7L1 MISSION shRNA Lentiviral Transduction Particles
ataxin 7-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152749.2-438s1c1
Sequence:CCGGCCAAGCCATAGAGAAGCATCACTCGAGTGATGCTTCTCTATGGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152749.2-90s1c1
Sequence:CCGGGCAACAAGAAGGAAGAGCAATCTCGAGATTGCTCTTCCTTCTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152749.2-387s1c1
Sequence:CCGGGCAAGACAACAGGAGAAATGACTCGAGTCATTTCTCCTGTTGTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152749.2-383s1c1
Sequence:CCGGGAAAGCAAGACAACAGGAGAACTCGAGTTCTCCTGTTGTCTTGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152749.2-931s1c1
Sequence:CCGGGCTCCCTTTCATTGTCTATATCTCGAGATATAGACAATGAAAGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152749.2-186s1c1
Sequence:CCGGCAAATTACACTGCTCCGACAACTCGAGTTGTCGGAGCAGTGTAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152749.2-246s1c1
Sequence:CCGGCAGGGAGGTTATGAGGCTTAACTCGAGTTAAGCCTCATAACCTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152749.2-476s1c1
Sequence:CCGGCGCAGAAGAGACGTACAACTTCTCGAGAAGTTGTACGTCTCTTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152749.3-279s21c1
Sequence:CCGGTATGCACTTATTTGGCCATTACTCGAGTAATGGCCAAATAAGTGCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152749.3-309s21c1
Sequence:CCGGTGACGACTTCTATCTCGTAGTCTCGAGACTACGAGATAGAAGTCGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)