EMAIL THIS PAGE TO A FRIEND

ATXN7L2

ataxin 7-like 2

64 Gene Product Result for
UniProtKB ID: Q5T6C5
Gene ID:
Mouse(72522) ataxin 7-like 2
Rat(310781) ataxin 7-like 2
cow(541097) ataxin 7-like 2
Horse(100629633) ataxin 7-like 2
domestic cat(101090708) ataxin 7-like 2
dog(490121) ataxin 7-like 2
sheep(101103448) ataxin 7-like 2
naked mole-rat(101700932) ataxin 7-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153340 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153340 Rosetta Predictions human pricing
XM_001070248 Rosetta Predictions rat pricing
XM_227583 Rosetta Predictions rat pricing
NM_175183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245382 predicted 295
2 SASI_Hs01_00245383 predicted 788
3 SASI_Hs01_00245384 predicted 383
4 SASI_Hs01_00245385 predicted 1009
5 SASI_Hs01_00245386 predicted 1326
6 SASI_Hs01_00245387 predicted 234
7 SASI_Hs01_00245388 predicted 1020
8 SASI_Hs01_00245389 predicted 957
9 SASI_Hs01_00245390 predicted 1670
10 SASI_Hs01_00245391 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330991 predicted 2047
2 SASI_Rn02_00330992 predicted 1477
3 SASI_Rn02_00330993 predicted 680
4 SASI_Rn02_00330994 predicted 217
5 SASI_Rn02_00330995 predicted 1094
6 SASI_Rn02_00330996 predicted 354
7 SASI_Rn02_00330997 predicted 2099
8 SASI_Rn02_00330998 predicted 1089
9 SASI_Rn02_00330999 predicted 1422
10 SASI_Rn02_00331000 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384532 predicted 2005
2 SASI_Rn02_00384533 predicted 2041
3 SASI_Rn02_00384534 predicted 2044
4 SASI_Rn02_00384535 predicted 2075
5 SASI_Rn02_00384536 predicted 2063
6 SASI_Rn02_00384537 predicted 2096
7 SASI_Rn02_00384538 predicted 2099
8 SASI_Rn02_00384539 predicted 2031
9 SASI_Rn02_00384540 predicted 1998
10 SASI_Rn02_00384541 predicted 2077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050535 predicted 1495
2 SASI_Mm01_00050536 predicted 1185
3 SASI_Mm01_00050538 predicted 1567
4 SASI_Mm01_00050539 predicted 869
5 SASI_Mm01_00050540 predicted 2237
6 SASI_Mm01_00050541 predicted 2123
7 SASI_Mm02_00345843 predicted 914
8 SASI_Mm01_00050542 predicted 1430
9 SASI_Mm02_00345844 predicted 2736
10 SASI_Mm01_00050543 predicted 2760
11 SASI_Mm01_00050537 predicted 2662
12 SASI_Mm01_00050544 predicted 2077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153340
ATXN7L2 MISSION shRNA Bacterial Glycerol Stock
ataxin 7-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-171s1c1
Sequence:CCGGCACGAAGAAGTTGGATGCCATCTCGAGATGGCATCCAACTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-385s1c1
Sequence:CCGGCAGAAATGCCATGTAGTGAATCTCGAGATTCACTACATGGCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-238s1c1
Sequence:CCGGCATGATGACTTCTACTTGGTTCTCGAGAACCAAGTAGAAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-237s1c1
Sequence:CCGGCCATGATGACTTCTACTTGGTCTCGAGACCAAGTAGAAGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-184s1c1
Sequence:CCGGGATGCCATGACCCTCATTAAACTCGAGTTTAATGAGGGTCATGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-1716s1c1
Sequence:CCGGCTTCTCGAAAGCGGAAGTTATCTCGAGATAACTTCCGCTTTCGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-187s1c1
Sequence:CCGGGCCATGACCCTCATTAAAGAACTCGAGTTCTTTAATGAGGGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-2175s1c1
Sequence:CCGGCCCATTAACGAGAAAGTGCCTCTCGAGAGGCACTTTCTCGTTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-1356s1c1
Sequence:CCGGCAGCACACACATGTGGAAGAACTCGAGTTCTTCCACATGTGTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153340
ATXN7L2 MISSION shRNA shRNA Plasmid DNA
ataxin 7-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-171s1c1
Sequence:CCGGCACGAAGAAGTTGGATGCCATCTCGAGATGGCATCCAACTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-385s1c1
Sequence:CCGGCAGAAATGCCATGTAGTGAATCTCGAGATTCACTACATGGCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-238s1c1
Sequence:CCGGCATGATGACTTCTACTTGGTTCTCGAGAACCAAGTAGAAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-237s1c1
Sequence:CCGGCCATGATGACTTCTACTTGGTCTCGAGACCAAGTAGAAGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-184s1c1
Sequence:CCGGGATGCCATGACCCTCATTAAACTCGAGTTTAATGAGGGTCATGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-1716s1c1
Sequence:CCGGCTTCTCGAAAGCGGAAGTTATCTCGAGATAACTTCCGCTTTCGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-187s1c1
Sequence:CCGGGCCATGACCCTCATTAAAGAACTCGAGTTCTTTAATGAGGGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-2175s1c1
Sequence:CCGGCCCATTAACGAGAAAGTGCCTCTCGAGAGGCACTTTCTCGTTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-1356s1c1
Sequence:CCGGCAGCACACACATGTGGAAGAACTCGAGTTCTTCCACATGTGTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153340
ATXN7L2 MISSION shRNA Lentiviral Transduction Particles
ataxin 7-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-171s1c1
Sequence:CCGGCACGAAGAAGTTGGATGCCATCTCGAGATGGCATCCAACTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-385s1c1
Sequence:CCGGCAGAAATGCCATGTAGTGAATCTCGAGATTCACTACATGGCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-238s1c1
Sequence:CCGGCATGATGACTTCTACTTGGTTCTCGAGAACCAAGTAGAAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-237s1c1
Sequence:CCGGCCATGATGACTTCTACTTGGTCTCGAGACCAAGTAGAAGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-184s1c1
Sequence:CCGGGATGCCATGACCCTCATTAAACTCGAGTTTAATGAGGGTCATGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-1716s1c1
Sequence:CCGGCTTCTCGAAAGCGGAAGTTATCTCGAGATAACTTCCGCTTTCGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-187s1c1
Sequence:CCGGGCCATGACCCTCATTAAAGAACTCGAGTTCTTTAATGAGGGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-2175s1c1
Sequence:CCGGCCCATTAACGAGAAAGTGCCTCTCGAGAGGCACTTTCTCGTTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153340.2-1356s1c1
Sequence:CCGGCAGCACACACATGTGGAAGAACTCGAGTTCTTCCACATGTGTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175183
ATXN7L2 MISSION shRNA Bacterial Glycerol Stock
ataxin 7-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-2441s1c1
Sequence:CCGGCCTTCTCGAAAGCGGAAGTTACTCGAGTAACTTCCGCTTTCGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-1736s1c1
Sequence:CCGGTCTCTGTCTAAGCAGACCTATCTCGAGATAGGTCTGCTTAGACAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-869s1c1
Sequence:CCGGGATGACTTCTATTTGGTTGTACTCGAGTACAACCAAATAGAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-2128s1c1
Sequence:CCGGCCATCTTGTCAGTCCATCTTTCTCGAGAAAGATGGACTGACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-2127s1c1
Sequence:CCGGCCCATCTTGTCAGTCCATCTTCTCGAGAAGATGGACTGACAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175183
ATXN7L2 MISSION shRNA shRNA Plasmid DNA
ataxin 7-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-2441s1c1
Sequence:CCGGCCTTCTCGAAAGCGGAAGTTACTCGAGTAACTTCCGCTTTCGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-1736s1c1
Sequence:CCGGTCTCTGTCTAAGCAGACCTATCTCGAGATAGGTCTGCTTAGACAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-869s1c1
Sequence:CCGGGATGACTTCTATTTGGTTGTACTCGAGTACAACCAAATAGAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-2128s1c1
Sequence:CCGGCCATCTTGTCAGTCCATCTTTCTCGAGAAAGATGGACTGACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-2127s1c1
Sequence:CCGGCCCATCTTGTCAGTCCATCTTCTCGAGAAGATGGACTGACAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175183
ATXN7L2 MISSION shRNA Lentiviral Transduction Particles
ataxin 7-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-2441s1c1
Sequence:CCGGCCTTCTCGAAAGCGGAAGTTACTCGAGTAACTTCCGCTTTCGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-1736s1c1
Sequence:CCGGTCTCTGTCTAAGCAGACCTATCTCGAGATAGGTCTGCTTAGACAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-869s1c1
Sequence:CCGGGATGACTTCTATTTGGTTGTACTCGAGTACAACCAAATAGAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-2128s1c1
Sequence:CCGGCCATCTTGTCAGTCCATCTTTCTCGAGAAAGATGGACTGACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175183.2-2127s1c1
Sequence:CCGGCCCATCTTGTCAGTCCATCTTCTCGAGAAGATGGACTGACAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks