EMAIL THIS PAGE TO A FRIEND

ATXN7L3

ataxin 7-like 3

272 Gene Product Result for
UniProtKB ID: Q14CW9, Q8IY68, Q96N40, Q9NPU5
Gene ID:
Mouse(217218) ataxin 7-like 3
Rat(287734) ataxin 7-like 3
Zebrafish(368510) ataxin 7-like 3
domestic cat(101098503) ataxin 7-like 3
cow(525252) ataxin 7-like 3
Horse(100064752) ataxin 7-like 3
dog(612754) ataxin 7-like 3
naked mole-rat(101720020) ataxin 7-like 3
sheep(101113945) ataxin 7-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001098836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001098836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001098833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098833 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098833 Rosetta Predictions human pricing
NM_020218 Rosetta Predictions human pricing
XM_213493 Rosetta Predictions rat pricing
NM_001098836 Rosetta Predictions mouse pricing
NM_001098837 Rosetta Predictions mouse pricing
XM_001003471 Rosetta Predictions mouse pricing
XM_895148 Rosetta Predictions mouse pricing
XM_903054 Rosetta Predictions mouse pricing
XM_903055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320134 predicted 841
2 SASI_Hs02_00320135 predicted 227
3 SASI_Hs02_00320136 predicted 1627
4 SASI_Hs02_00320137 predicted 847
5 SASI_Hs02_00320138 predicted 1328
6 SASI_Hs02_00320139 predicted 251
7 SASI_Hs02_00320140 predicted 883
8 SASI_Hs02_00320141 predicted 1335
9 SASI_Hs02_00320142 predicted 793
10 SASI_Hs02_00320143 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353152 predicted 862
2 SASI_Hs02_00353153 predicted 218
3 SASI_Hs02_00353154 predicted 1650
4 SASI_Hs02_00353155 predicted 869
5 SASI_Hs02_00353156 predicted 1351
6 SASI_Hs02_00353157 predicted 252
7 SASI_Hs02_00353158 predicted 909
8 SASI_Hs02_00353159 predicted 1349
9 SASI_Hs02_00353160 predicted 809
10 SASI_Hs02_00353161 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374646 predicted 1105
2 SASI_Rn02_00374647 predicted 929
3 SASI_Rn02_00374648 predicted 1486
4 SASI_Rn02_00374649 predicted 1072
5 SASI_Rn02_00374650 predicted 1414
6 SASI_Rn02_00374651 predicted 1297
7 SASI_Rn02_00374652 predicted 1588
8 SASI_Rn02_00374653 predicted 1979
9 SASI_Rn02_00374654 predicted 1454
10 SASI_Rn02_00374655 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301471 predicted 1551
2 SASI_Mm02_00301472 predicted 443
3 SASI_Mm02_00301473 predicted 1117
4 SASI_Mm02_00301474 predicted 1546
5 SASI_Mm02_00301475 predicted 484
6 SASI_Mm02_00301476 predicted 1241
7 SASI_Mm02_00301477 predicted 1600
8 SASI_Mm02_00301478 predicted 446
9 SASI_Mm02_00301479 predicted 1103
10 SASI_Mm02_00301480 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301481 predicted 1528
2 SASI_Mm02_00301482 predicted 449
3 SASI_Mm02_00301483 predicted 1092
4 SASI_Mm02_00301484 predicted 1531
5 SASI_Mm02_00301485 predicted 489
6 SASI_Mm02_00301486 predicted 1218
7 SASI_Mm02_00301487 predicted 1580
8 SASI_Mm02_00301488 predicted 447
9 SASI_Mm02_00301489 predicted 1080
10 SASI_Mm02_00301490 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259698 predicted 814
2 SASI_Mm01_00259699 predicted 1585
3 SASI_Mm01_00259700 predicted 1224
4 SASI_Mm01_00259701 predicted 1586
5 SASI_Mm01_00259702 predicted 1546
6 SASI_Mm01_00259703 predicted 648
7 SASI_Mm01_00259704 predicted 1329
8 SASI_Mm01_00259705 predicted 779
9 SASI_Mm01_00259706 predicted 492
10 SASI_Mm01_00259707 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275061 predicted 837
2 SASI_Mm01_00275062 predicted 1610
3 SASI_Mm01_00275063 predicted 1251
4 SASI_Mm01_00275064 predicted 1613
5 SASI_Mm01_00275065 predicted 1566
6 SASI_Mm01_00275066 predicted 759
7 SASI_Mm01_00275067 predicted 1355
8 SASI_Mm01_00275068 predicted 805
9 SASI_Mm01_00275069 predicted 492
10 SASI_Mm01_00275070 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234855 predicted 427
2 SASI_Mm01_00234856 predicted 826
3 SASI_Mm01_00234857 predicted 680
4 SASI_Mm01_00234858 predicted 1236
5 SASI_Mm01_00234859 predicted 659
6 SASI_Mm01_00234860 predicted 1337
7 SASI_Mm01_00234861 predicted 789
8 SASI_Mm01_00234862 predicted 418
9 SASI_Mm01_00234863 predicted 502
10 SASI_Mm01_00234864 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252943 predicted 870
2 SASI_Mm01_00252944 predicted 820
3 SASI_Mm01_00252945 predicted 1644
4 SASI_Mm01_00252946 predicted 1289
5 SASI_Mm01_00252947 predicted 1641
6 SASI_Mm01_00252948 predicted 1606
7 SASI_Mm01_00252949 predicted 1382
8 SASI_Mm01_00252950 predicted 787
9 SASI_Mm01_00252951 predicted 495
10 SASI_Mm01_00252952 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098836
VALIDATED
ATXN7L3 MISSION shRNA Bacterial Glycerol Stock
ataxin 7-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001098836.1-1475s21c1
Sequence:CCGGCAGGCAGAGGATCCAATTATGCTCGAGCATAATTGGATCCTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001098836.1-800s21c1
Sequence:CCGGTCGAAGATCCAAGTCTCTAAACTCGAGTTTAGAGACTTGGATCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098836.1-546s21c1
Sequence:CCGGCCCAATTGCAGCCGCAGTATTCTCGAGAATACTGCGGCTGCAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001098836.1-1008s21c1
Sequence:CCGGAGGCGAACCGTACGGATTTATCTCGAGATAAATCCGTACGGTTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098836.1-775s21c1
Sequence:CCGGTCCCATTCCAGAACCCTAATTCTCGAGAATTAGGGTTCTGGAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098836
VALIDATED
ATXN7L3 MISSION shRNA shRNA Plasmid DNA
ataxin 7-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001098836.1-1475s21c1
Sequence:CCGGCAGGCAGAGGATCCAATTATGCTCGAGCATAATTGGATCCTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001098836.1-800s21c1
Sequence:CCGGTCGAAGATCCAAGTCTCTAAACTCGAGTTTAGAGACTTGGATCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098836.1-546s21c1
Sequence:CCGGCCCAATTGCAGCCGCAGTATTCTCGAGAATACTGCGGCTGCAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001098836.1-1008s21c1
Sequence:CCGGAGGCGAACCGTACGGATTTATCTCGAGATAAATCCGTACGGTTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098836.1-775s21c1
Sequence:CCGGTCCCATTCCAGAACCCTAATTCTCGAGAATTAGGGTTCTGGAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098836
VALIDATED
ATXN7L3 MISSION shRNA Lentiviral Transduction Particles
ataxin 7-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001098836.1-1475s21c1
Sequence:CCGGCAGGCAGAGGATCCAATTATGCTCGAGCATAATTGGATCCTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001098836.1-800s21c1
Sequence:CCGGTCGAAGATCCAAGTCTCTAAACTCGAGTTTAGAGACTTGGATCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098836.1-546s21c1
Sequence:CCGGCCCAATTGCAGCCGCAGTATTCTCGAGAATACTGCGGCTGCAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001098836.1-1008s21c1
Sequence:CCGGAGGCGAACCGTACGGATTTATCTCGAGATAAATCCGTACGGTTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098836.1-775s21c1
Sequence:CCGGTCCCATTCCAGAACCCTAATTCTCGAGAATTAGGGTTCTGGAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098833
ATXN7L3 MISSION shRNA Bacterial Glycerol Stock
ataxin 7-like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-583s21c1
Sequence:CCGGTCGAAGATCCAAGTCATTAAACTCGAGTTTAATGACTTGGATCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-448s21c1
Sequence:CCGGGATTGCCAATAGCAACAATATCTCGAGATATTGTTGCTATTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-791s21c1
Sequence:CCGGAGGCGAACCGTACGGATTTATCTCGAGATAAATCCGTACGGTTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098833.1-1258s21c1
Sequence:CCGGGCAGGCAGAGGATCCGATTATCTCGAGATAATCGGATCCTCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-843s21c1
Sequence:CCGGTCGAGAGCTCCCTGGATAATGCTCGAGCATTATCCAGGGAGCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098833
ATXN7L3 MISSION shRNA shRNA Plasmid DNA
ataxin 7-like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-583s21c1
Sequence:CCGGTCGAAGATCCAAGTCATTAAACTCGAGTTTAATGACTTGGATCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-448s21c1
Sequence:CCGGGATTGCCAATAGCAACAATATCTCGAGATATTGTTGCTATTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-791s21c1
Sequence:CCGGAGGCGAACCGTACGGATTTATCTCGAGATAAATCCGTACGGTTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098833.1-1258s21c1
Sequence:CCGGGCAGGCAGAGGATCCGATTATCTCGAGATAATCGGATCCTCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-843s21c1
Sequence:CCGGTCGAGAGCTCCCTGGATAATGCTCGAGCATTATCCAGGGAGCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098833
ATXN7L3 MISSION shRNA Lentiviral Transduction Particles
ataxin 7-like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-583s21c1
Sequence:CCGGTCGAAGATCCAAGTCATTAAACTCGAGTTTAATGACTTGGATCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-448s21c1
Sequence:CCGGGATTGCCAATAGCAACAATATCTCGAGATATTGTTGCTATTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-791s21c1
Sequence:CCGGAGGCGAACCGTACGGATTTATCTCGAGATAAATCCGTACGGTTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098833.1-1258s21c1
Sequence:CCGGGCAGGCAGAGGATCCGATTATCTCGAGATAATCGGATCCTCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098833.1-843s21c1
Sequence:CCGGTCGAGAGCTCCCTGGATAATGCTCGAGCATTATCCAGGGAGCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks