EMAIL THIS PAGE TO A FRIEND

ATXN7L3B

ataxin 7-like 3B

41 Gene Product Result for
UniProtKB ID: Q96GX2
Gene ID:
Mouse(382423) ataxin 7-like 3B
Rat(100192313) ataxin 7-like 3B
sheep(101121247) ataxin 7-like 3B
domestic cat(101082418) ataxin 7-like 3B
cow(777786) ataxin 7-like 3B
dog(100685115) ataxin 7-like 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001136262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136262 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU168871 MISSION® esiRNA esiRNA targeting mouse Atxn7l3b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_015371 Rosetta Predictions human pricing
NM_001033474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381304 predicted 672
2 SASI_Hs02_00381305 predicted 1453
3 SASI_Hs02_00381306 predicted 1407
4 SASI_Hs02_00381307 predicted 1323
5 SASI_Hs02_00381308 predicted 1364
6 SASI_Hs02_00381309 predicted 513
7 SASI_Hs02_00381310 predicted 1167
8 SASI_Hs02_00381311 predicted 1348
9 SASI_Hs02_00381312 predicted 903
10 SASI_Hs02_00381313 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288827 predicted 981
2 SASI_Mm02_00288828 predicted 973
3 SASI_Mm02_00288829 predicted 809
4 SASI_Mm02_00288830 predicted 980
5 SASI_Mm02_00288831 predicted 977
6 SASI_Mm02_00288832 predicted 798
7 SASI_Mm02_00288833 predicted 356
8 SASI_Mm02_00288834 predicted 940
9 SASI_Mm02_00288835 predicted 940
10 SASI_Mm02_00288836 predicted 1033
11 SASI_Mm01_00108370 predicted 1040
12 SASI_Mm01_00108371 predicted 211
13 SASI_Mm01_00108372 predicted 1108
14 SASI_Mm01_00108373 predicted 985
15 SASI_Mm01_00108374 predicted 797
16 SASI_Mm01_00108375 predicted 1079
17 SASI_Mm01_00108376 predicted 1075
18 SASI_Mm01_00108377 predicted 1024
19 SASI_Mm01_00108378 predicted 835
20 SASI_Mm01_00108379 predicted 1080
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033474
VALIDATED
ATXN7L3B MISSION shRNA Bacterial Glycerol Stock
ataxin 7-like 3B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033474.2-594s21c1
Sequence:CCGGAGTAGTCACCACCTGAGAGAGCTCGAGCTCTCTCAGGTGGTGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033474.2-3004s21c1
Sequence:CCGGGTAATGGGTTTGCTCATATTACTCGAGTAATATGAGCAAACCCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033474.2-425s21c1
Sequence:CCGGGTCAAGTGTGGCTACTTCTACCTCGAGGTAGAAGTAGCCACACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033474.2-363s21c1
Sequence:CCGGAGATCTATGTAGACCTGATAGCTCGAGCTATCAGGTCTACATAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033474
VALIDATED
ATXN7L3B MISSION shRNA shRNA Plasmid DNA
ataxin 7-like 3B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033474.2-594s21c1
Sequence:CCGGAGTAGTCACCACCTGAGAGAGCTCGAGCTCTCTCAGGTGGTGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033474.2-3004s21c1
Sequence:CCGGGTAATGGGTTTGCTCATATTACTCGAGTAATATGAGCAAACCCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033474.2-425s21c1
Sequence:CCGGGTCAAGTGTGGCTACTTCTACCTCGAGGTAGAAGTAGCCACACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033474.2-363s21c1
Sequence:CCGGAGATCTATGTAGACCTGATAGCTCGAGCTATCAGGTCTACATAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033474
VALIDATED
ATXN7L3B MISSION shRNA Lentiviral Transduction Particles
ataxin 7-like 3B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033474.2-594s21c1
Sequence:CCGGAGTAGTCACCACCTGAGAGAGCTCGAGCTCTCTCAGGTGGTGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033474.2-3004s21c1
Sequence:CCGGGTAATGGGTTTGCTCATATTACTCGAGTAATATGAGCAAACCCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033474.2-425s21c1
Sequence:CCGGGTCAAGTGTGGCTACTTCTACCTCGAGGTAGAAGTAGCCACACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001033474.2-363s21c1
Sequence:CCGGAGATCTATGTAGACCTGATAGCTCGAGCTATCAGGTCTACATAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136262
ATXN7L3B MISSION shRNA Bacterial Glycerol Stock
ataxin 7-like 3B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-401s21c1
Sequence:CCGGAGATTTACGTAGACCTGATAGCTCGAGCTATCAGGTCTACGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-518s21c1
Sequence:CCGGTTGGCATTCAGCCAGTGGAAGCTCGAGCTTCCACTGGCTGAATGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-368s21c1
Sequence:CCGGTGGATACTAACAAGCTAGAGGCTCGAGCCTCTAGCTTGTTAGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-479s21c1
Sequence:CCGGTCTACCTGGAGTTCGCAGAGACTCGAGTCTCTGCGAACTCCAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136262.1-3331s21c1
Sequence:CCGGATCACCCTGCAATCCTATTATCTCGAGATAATAGGATTGCAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136262
ATXN7L3B MISSION shRNA shRNA Plasmid DNA
ataxin 7-like 3B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-401s21c1
Sequence:CCGGAGATTTACGTAGACCTGATAGCTCGAGCTATCAGGTCTACGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-518s21c1
Sequence:CCGGTTGGCATTCAGCCAGTGGAAGCTCGAGCTTCCACTGGCTGAATGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-368s21c1
Sequence:CCGGTGGATACTAACAAGCTAGAGGCTCGAGCCTCTAGCTTGTTAGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-479s21c1
Sequence:CCGGTCTACCTGGAGTTCGCAGAGACTCGAGTCTCTGCGAACTCCAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136262.1-3331s21c1
Sequence:CCGGATCACCCTGCAATCCTATTATCTCGAGATAATAGGATTGCAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136262
ATXN7L3B MISSION shRNA Lentiviral Transduction Particles
ataxin 7-like 3B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-401s21c1
Sequence:CCGGAGATTTACGTAGACCTGATAGCTCGAGCTATCAGGTCTACGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-518s21c1
Sequence:CCGGTTGGCATTCAGCCAGTGGAAGCTCGAGCTTCCACTGGCTGAATGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-368s21c1
Sequence:CCGGTGGATACTAACAAGCTAGAGGCTCGAGCCTCTAGCTTGTTAGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136262.1-479s21c1
Sequence:CCGGTCTACCTGGAGTTCGCAGAGACTCGAGTCTCTGCGAACTCCAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136262.1-3331s21c1
Sequence:CCGGATCACCCTGCAATCCTATTATCTCGAGATAATAGGATTGCAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks