EMAIL THIS PAGE TO A FRIEND

AUH

AU RNA binding protein/enoyl-CoA hydratase

UniProtKB ID: Q13825, B1ALV7, B1ALV8, Q8WUE4
Gene ID:
Human(549) Summary: The methylglutaconyl-CoA hydratase, mitochondrial protein binds to the AU-rich element (ARE), a common element found in the 3' UTR of rapidly decaying mRNA such as c-fos, c-myc and granulocyte/ macrophage colony stimulating factor. ARE elements are involved in directing RNA to rapid degradation and deadenylation. AUH is also homologous to enol-CoA hydratase, an enzyme involved in fatty acid degradation, and has been shown to have intrinsic hydratase enzymatic activity. AUH is thus a bifunctional chimera between RNA binding and metabolic enzyme activity. A possible subcellular localization in the mitochondria has been demonstrated for the mouse homolog of this protein which shares 92% identity with the human protein. It has been suggested that AUH may have a novel role as a mitochondrial located AU-binding protein. Human AUH is expressed as a single mRNA species of 1.8 kb, and translated as a 40-kDa precursor protein which is subsequently processed to a 32-kDa mature form. [provided by RefSeq, May 2010]
Mouse(11992) AU RNA binding protein/enoyl-coenzyme A hydratase
Rat(361215) AU RNA binding protein/enoyl-CoA hydratase
naked mole-rat(101719138) AU RNA binding protein/enoyl-CoA hydratase
domestic guinea pig(100716715) AU RNA binding protein/enoyl-CoA hydratase
sheep(101109520) AU RNA binding protein/enoyl-CoA hydratase
Zebrafish(445182) AU RNA binding protein/enoyl-Coenzyme A hydratase
chicken(427269) AU RNA binding protein/enoyl-CoA hydratase
domestic cat(101096361) AU RNA binding protein/enoyl-CoA hydratase
cow(614716) AU RNA binding protein/enoyl-CoA hydratase
dog(476348) AU RNA binding protein/enoyl-CoA hydratase
Gene Class: Dehydratase
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001698 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001698 Rosetta Predictions human pricing
NM_001108407 Rosetta Predictions rat pricing
NM_016709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073682 predicted 1136
2 SASI_Hs01_00073683 predicted 1147
3 SASI_Hs01_00073684 predicted 962
4 SASI_Hs01_00073685 predicted 566
5 SASI_Hs01_00073687 predicted 1034
6 SASI_Hs02_00332365 predicted 542
7 SASI_Hs01_00073688 predicted 563
8 SASI_Hs01_00073689 predicted 947
9 SASI_Hs01_00073690 predicted 1136
10 SASI_Hs01_00073691 predicted 1131
11 SASI_Hs01_00073686 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238359 predicted 252
2 SASI_Rn02_00238360 predicted 308
3 SASI_Rn02_00238361 predicted 608
4 SASI_Rn02_00238362 predicted 996
5 SASI_Rn02_00238363 predicted 284
6 SASI_Rn02_00238364 predicted 722
7 SASI_Rn02_00238365 predicted 607
8 SASI_Rn02_00238366 predicted 1022
9 SASI_Rn02_00238367 predicted 1026
10 SASI_Rn02_00238368 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115835 predicted 580
2 SASI_Mm01_00115836 predicted 361
3 SASI_Mm01_00115837 predicted 343
4 SASI_Mm01_00115838 predicted 710
5 SASI_Mm01_00115839 predicted 823
6 SASI_Mm02_00323389 predicted 405
7 SASI_Mm01_00115841 predicted 300
8 SASI_Mm01_00115842 predicted 301
9 SASI_Mm01_00115843 predicted 220
10 SASI_Mm01_00115844 predicted 594
11 SASI_Mm01_00115840 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001698
VALIDATED
AUH MISSION shRNA Bacterial Glycerol Stock
AU RNA binding protein/enoyl-CoA hydratase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-1167s21c1
Sequence:CCGGAGATTATTCATACGGTGTAATCTCGAGATTACACCGTATGAATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-426s21c1
Sequence:CCGGAGTGAAGTCCCAGGGATATTCCTCGAGGAATATCCCTGGGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-519s21c1
Sequence:CCGGAGAGCAGTGATTAACGATATTCTCGAGAATATCGTTAATCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-567s21c1
Sequence:CCGGGCAATAGATGGACTCGCTTTACTCGAGTAAAGCGAGTCCATCTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-308s21c1
Sequence:CCGGGCTTGGAATAAACAGAGCTTACTCGAGTAAGCTCTGTTTATTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001698.1-1148s1c1
Sequence:CCGGCGGTGTAATAAGCGTCTGGAACTCGAGTTCCAGACGCTTATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001698.1-365s1c1
Sequence:CCGGGATAAGAAAGTACGGACCATACTCGAGTATGGTCCGTACTTTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_001698.1-277s1c1
Sequence:CCGGGCTTGGAATAAACAGAGCTTACTCGAGTAAGCTCTGTTTATTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_001698.1-899s1c1
Sequence:CCGGGTCGATTTAGTAACAGGGTTACTCGAGTAACCCTGTTACTAAATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001698.1-1003s1c1
Sequence:CCGGCCCTCGCTATAAAGGAGAATACTCGAGTATTCTCCTTTATAGCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001698
VALIDATED
AUH MISSION shRNA shRNA Plasmid DNA
AU RNA binding protein/enoyl-CoA hydratase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-1167s21c1
Sequence:CCGGAGATTATTCATACGGTGTAATCTCGAGATTACACCGTATGAATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-426s21c1
Sequence:CCGGAGTGAAGTCCCAGGGATATTCCTCGAGGAATATCCCTGGGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-519s21c1
Sequence:CCGGAGAGCAGTGATTAACGATATTCTCGAGAATATCGTTAATCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-567s21c1
Sequence:CCGGGCAATAGATGGACTCGCTTTACTCGAGTAAAGCGAGTCCATCTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-308s21c1
Sequence:CCGGGCTTGGAATAAACAGAGCTTACTCGAGTAAGCTCTGTTTATTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001698.1-1148s1c1
Sequence:CCGGCGGTGTAATAAGCGTCTGGAACTCGAGTTCCAGACGCTTATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001698.1-365s1c1
Sequence:CCGGGATAAGAAAGTACGGACCATACTCGAGTATGGTCCGTACTTTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_001698.1-277s1c1
Sequence:CCGGGCTTGGAATAAACAGAGCTTACTCGAGTAAGCTCTGTTTATTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_001698.1-899s1c1
Sequence:CCGGGTCGATTTAGTAACAGGGTTACTCGAGTAACCCTGTTACTAAATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001698.1-1003s1c1
Sequence:CCGGCCCTCGCTATAAAGGAGAATACTCGAGTATTCTCCTTTATAGCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001698
VALIDATED
AUH MISSION shRNA Lentiviral Transduction Particles
AU RNA binding protein/enoyl-CoA hydratase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-1167s21c1
Sequence:CCGGAGATTATTCATACGGTGTAATCTCGAGATTACACCGTATGAATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-426s21c1
Sequence:CCGGAGTGAAGTCCCAGGGATATTCCTCGAGGAATATCCCTGGGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-519s21c1
Sequence:CCGGAGAGCAGTGATTAACGATATTCTCGAGAATATCGTTAATCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-567s21c1
Sequence:CCGGGCAATAGATGGACTCGCTTTACTCGAGTAAAGCGAGTCCATCTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001698.2-308s21c1
Sequence:CCGGGCTTGGAATAAACAGAGCTTACTCGAGTAAGCTCTGTTTATTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001698.1-1148s1c1
Sequence:CCGGCGGTGTAATAAGCGTCTGGAACTCGAGTTCCAGACGCTTATTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001698.1-365s1c1
Sequence:CCGGGATAAGAAAGTACGGACCATACTCGAGTATGGTCCGTACTTTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_001698.1-277s1c1
Sequence:CCGGGCTTGGAATAAACAGAGCTTACTCGAGTAAGCTCTGTTTATTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_001698.1-899s1c1
Sequence:CCGGGTCGATTTAGTAACAGGGTTACTCGAGTAACCCTGTTACTAAATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001698.1-1003s1c1
Sequence:CCGGCCCTCGCTATAAAGGAGAATACTCGAGTATTCTCCTTTATAGCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016709
VALIDATED
AUH MISSION shRNA Bacterial Glycerol Stock
AU RNA binding protein/enoyl-CoA hydratase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016709.2-1142s1c1
Sequence:CCGGCAGATTTATAAAGCTAGCAATCTCGAGATTGCTAGCTTTATAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.2-306s1c1
Sequence:CCGGGGATGCATTAAAGTCAGATAACTCGAGTTATCTGACTTTAATGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-822s21c1
Sequence:CCGGAGTGGCCAAACTAGCAATTAACTCGAGTTAATTGCTAGTTTGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-1119s21c1
Sequence:CCGGCTGTGCGCCATGTCATATTTACTCGAGTAAATATGACATGGCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016709.2-586s21c1
Sequence:CCGGGAAACAAAGTTGGCAATTATTCTCGAGAATAATTGCCAACTTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-324s21c1
Sequence:CCGGTAAGAAAGTTCGGACCATTATCTCGAGATAATGGTCCGAACTTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-440s21c1
Sequence:CCGGAGATCCGATCGGTGATCAATGCTCGAGCATTGATCACCGATCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.1-373s1c1
Sequence:CCGGCGGACCATTATCATCAGAAGTCTCGAGACTTCTGATGATAATGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.1-622s1c1
Sequence:CCGGGTTGAAACAAAGTTGGCAATTCTCGAGAATTGCCAACTTTGTTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.1-865s1c1
Sequence:CCGGGCCAAACTAGCAATTAACCAACTCGAGTTGGTTAATTGCTAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016709
VALIDATED
AUH MISSION shRNA shRNA Plasmid DNA
AU RNA binding protein/enoyl-CoA hydratase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016709.2-1142s1c1
Sequence:CCGGCAGATTTATAAAGCTAGCAATCTCGAGATTGCTAGCTTTATAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.2-306s1c1
Sequence:CCGGGGATGCATTAAAGTCAGATAACTCGAGTTATCTGACTTTAATGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-822s21c1
Sequence:CCGGAGTGGCCAAACTAGCAATTAACTCGAGTTAATTGCTAGTTTGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-1119s21c1
Sequence:CCGGCTGTGCGCCATGTCATATTTACTCGAGTAAATATGACATGGCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016709.2-586s21c1
Sequence:CCGGGAAACAAAGTTGGCAATTATTCTCGAGAATAATTGCCAACTTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-324s21c1
Sequence:CCGGTAAGAAAGTTCGGACCATTATCTCGAGATAATGGTCCGAACTTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-440s21c1
Sequence:CCGGAGATCCGATCGGTGATCAATGCTCGAGCATTGATCACCGATCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.1-373s1c1
Sequence:CCGGCGGACCATTATCATCAGAAGTCTCGAGACTTCTGATGATAATGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.1-622s1c1
Sequence:CCGGGTTGAAACAAAGTTGGCAATTCTCGAGAATTGCCAACTTTGTTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.1-865s1c1
Sequence:CCGGGCCAAACTAGCAATTAACCAACTCGAGTTGGTTAATTGCTAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016709
VALIDATED
AUH MISSION shRNA Lentiviral Transduction Particles
AU RNA binding protein/enoyl-CoA hydratase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016709.2-1142s1c1
Sequence:CCGGCAGATTTATAAAGCTAGCAATCTCGAGATTGCTAGCTTTATAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.2-306s1c1
Sequence:CCGGGGATGCATTAAAGTCAGATAACTCGAGTTATCTGACTTTAATGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-822s21c1
Sequence:CCGGAGTGGCCAAACTAGCAATTAACTCGAGTTAATTGCTAGTTTGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-1119s21c1
Sequence:CCGGCTGTGCGCCATGTCATATTTACTCGAGTAAATATGACATGGCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016709.2-586s21c1
Sequence:CCGGGAAACAAAGTTGGCAATTATTCTCGAGAATAATTGCCAACTTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-324s21c1
Sequence:CCGGTAAGAAAGTTCGGACCATTATCTCGAGATAATGGTCCGAACTTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016709.2-440s21c1
Sequence:CCGGAGATCCGATCGGTGATCAATGCTCGAGCATTGATCACCGATCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.1-373s1c1
Sequence:CCGGCGGACCATTATCATCAGAAGTCTCGAGACTTCTGATGATAATGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.1-622s1c1
Sequence:CCGGGTTGAAACAAAGTTGGCAATTCTCGAGAATTGCCAACTTTGTTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016709.1-865s1c1
Sequence:CCGGGCCAAACTAGCAATTAACCAACTCGAGTTGGTTAATTGCTAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks