EMAIL THIS PAGE TO A FRIEND

AUNIP

aurora kinase A and ninein interacting protein

58 Gene Product Result for
Synonyms: AIBP C1orf135
UniProtKB ID: Q9H7T9, C9EI59, Q53F70
Gene ID:
Rat(689656) aurora kinase A and ninein interacting protein
domestic cat(101082072) aurora kinase A and ninein interacting protein
cow(539251) aurora kinase A and ninein interacting protein
dog(100688925) aurora kinase A and ninein interacting protein
sheep(101114173) aurora kinase A and ninein interacting protein
domestic guinea pig(100733327) aurora kinase A and ninein interacting protein
naked mole-rat(101700556) aurora kinase A and ninein interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024037 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014111 MISSION® esiRNA esiRNA targeting human C1orf135 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024037 Rosetta Predictions human pricing
XM_001071529 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120242 predicted 1048
2 SASI_Hs02_00356460 predicted 305
3 SASI_Hs02_00356461 predicted 238
4 SASI_Hs01_00120243 predicted 782
5 SASI_Hs01_00120244 predicted 919
6 SASI_Hs01_00120245 predicted 882
7 SASI_Hs01_00120246 predicted 939
8 SASI_Hs01_00120247 predicted 1006
9 SASI_Hs01_00120248 predicted 657
10 SASI_Hs01_00120249 predicted 915
11 SASI_Hs01_00120250 predicted 584
12 SASI_Hs01_00120251 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335440 predicted 207
2 SASI_Rn02_00335441 predicted 252
3 SASI_Rn02_00335442 predicted 416
4 SASI_Rn02_00335443 predicted 406
5 SASI_Rn02_00335444 predicted 567
6 SASI_Rn02_00335445 predicted 291
7 SASI_Rn02_00335446 predicted 417
8 SASI_Rn02_00335447 predicted 525
9 SASI_Rn02_00335448 predicted 257
10 SASI_Rn02_00335449 predicted 886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024037
VALIDATED
AUNIP MISSION shRNA Bacterial Glycerol Stock
aurora kinase A and ninein interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024037.1-66s1c1
Sequence:CCGGGCGGAAAGTGCAGACACATTTCTCGAGAAATGTGTCTGCACTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-1177s1c1
Sequence:CCGGGCATGGGATGAAGTTGTCATTCTCGAGAATGACAACTTCATCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-1203s1c1
Sequence:CCGGGCATCTTCTCTGTGTAAATAACTCGAGTTATTTACACAGAGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-604s1c1
Sequence:CCGGCATGAGTCTAAGAAGAACTATCTCGAGATAGTTCTTCTTAGACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024037.1-796s1c1
Sequence:CCGGCGTAGTCCAGTTTCTGTGTTTCTCGAGAAACACAGAAACTGGACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-1038s1c1
Sequence:CCGGCTCTGAAGGTAATCAAGTTATCTCGAGATAACTTGATTACCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024037.1-125s21c1
Sequence:CCGGGAGAAAGAAAGGCTAATATTTCTCGAGAAATATTAGCCTTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024037.1-297s21c1
Sequence:CCGGTGCGACCCAGCTAGACCATTTCTCGAGAAATGGTCTAGCTGGGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024037.1-263s21c1
Sequence:CCGGCAGAAAGTCAGATCAACAAAGCTCGAGCTTTGTTGATCTGACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024037
VALIDATED
AUNIP MISSION shRNA shRNA Plasmid DNA
aurora kinase A and ninein interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024037.1-66s1c1
Sequence:CCGGGCGGAAAGTGCAGACACATTTCTCGAGAAATGTGTCTGCACTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-1177s1c1
Sequence:CCGGGCATGGGATGAAGTTGTCATTCTCGAGAATGACAACTTCATCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-1203s1c1
Sequence:CCGGGCATCTTCTCTGTGTAAATAACTCGAGTTATTTACACAGAGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-604s1c1
Sequence:CCGGCATGAGTCTAAGAAGAACTATCTCGAGATAGTTCTTCTTAGACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024037.1-796s1c1
Sequence:CCGGCGTAGTCCAGTTTCTGTGTTTCTCGAGAAACACAGAAACTGGACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-1038s1c1
Sequence:CCGGCTCTGAAGGTAATCAAGTTATCTCGAGATAACTTGATTACCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024037.1-125s21c1
Sequence:CCGGGAGAAAGAAAGGCTAATATTTCTCGAGAAATATTAGCCTTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024037.1-297s21c1
Sequence:CCGGTGCGACCCAGCTAGACCATTTCTCGAGAAATGGTCTAGCTGGGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024037.1-263s21c1
Sequence:CCGGCAGAAAGTCAGATCAACAAAGCTCGAGCTTTGTTGATCTGACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024037
VALIDATED
AUNIP MISSION shRNA Lentiviral Transduction Particles
aurora kinase A and ninein interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024037.1-66s1c1
Sequence:CCGGGCGGAAAGTGCAGACACATTTCTCGAGAAATGTGTCTGCACTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-1177s1c1
Sequence:CCGGGCATGGGATGAAGTTGTCATTCTCGAGAATGACAACTTCATCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-1203s1c1
Sequence:CCGGGCATCTTCTCTGTGTAAATAACTCGAGTTATTTACACAGAGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-604s1c1
Sequence:CCGGCATGAGTCTAAGAAGAACTATCTCGAGATAGTTCTTCTTAGACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024037.1-796s1c1
Sequence:CCGGCGTAGTCCAGTTTCTGTGTTTCTCGAGAAACACAGAAACTGGACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024037.1-1038s1c1
Sequence:CCGGCTCTGAAGGTAATCAAGTTATCTCGAGATAACTTGATTACCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024037.1-125s21c1
Sequence:CCGGGAGAAAGAAAGGCTAATATTTCTCGAGAAATATTAGCCTTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024037.1-297s21c1
Sequence:CCGGTGCGACCCAGCTAGACCATTTCTCGAGAAATGGTCTAGCTGGGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024037.1-263s21c1
Sequence:CCGGCAGAAAGTCAGATCAACAAAGCTCGAGCTTTGTTGATCTGACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks