EMAIL THIS PAGE TO A FRIEND

AUP1

ancient ubiquitous protein 1

59 Gene Product Result for
UniProtKB ID: Q9Y679, C0H5W8, Q9H866, Q9UNQ6, Q9Y685
Gene ID:
Human(550) Summary: This gene encodes a protein that contains a domain with homology to the ancient conserved region of the archain 1 gene and a domain that may be involved in binding ubiquitin-conjugating enzymes. The protein encoded by this gene has been shown to bind to the conserved membrane-proximal sequence of the cytoplasmic tail of integrin alpha(IIb) subunits. These subunits play a crucial role in the integrin alpha(IIb)beta(3) inside-out signalling in platelets and megakaryocytes that leads to platelet aggregation and thrombus formation. This gene overlaps the gene for mitochondrial serine protease 25. [provided by RefSeq, Jul 2008]
Mouse(11993) ancient ubiquitous protein 1
Rat(680423) ancient ubiquitous protein 1
Zebrafish(324654) ancient ubiquitous protein 1
cow(509130) ancient ubiquitous protein 1
domestic cat(101087730) ancient ubiquitous protein 1
dog(475783) ancient ubiquitous protein 1
chicken(769206) ancient ubiquitous protein 1
naked mole-rat(101724866) ancient ubiquitous protein 1
domestic guinea pig(100734345) ancient ubiquitous protein 1
sheep(101119707) ancient ubiquitous protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181575 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012103 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181575 Rosetta Predictions human pricing
NM_001079899 Rosetta Predictions rat pricing
NM_007517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370182 predicted 1228
2 SASI_Hs01_00193155 predicted 862
3 SASI_Hs01_00193156 predicted 1322
4 SASI_Hs01_00193157 predicted 1249
5 SASI_Hs01_00193158 predicted 1015
6 SASI_Hs01_00193159 predicted 621
7 SASI_Hs02_00370183 predicted 880
8 SASI_Hs01_00193161 predicted 1326
9 SASI_Hs01_00193162 predicted 497
10 SASI_Hs01_00193163 predicted 525
11 SASI_Hs01_00193160 predicted 1259
12 SASI_Hs01_00193164 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208299 predicted 829
2 SASI_Rn02_00208300 predicted 925
3 SASI_Rn02_00208301 predicted 600
4 SASI_Rn02_00208302 predicted 1000
5 SASI_Rn02_00208303 predicted 540
6 SASI_Rn02_00208304 predicted 684
7 SASI_Rn02_00208305 predicted 794
8 SASI_Rn02_00208306 predicted 821
9 SASI_Rn02_00208307 predicted 759
10 SASI_Rn02_00208308 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075883 predicted 628
2 SASI_Mm01_00075884 predicted 636
3 SASI_Mm01_00075885 predicted 884
4 SASI_Mm01_00075886 predicted 955
5 SASI_Mm01_00075887 predicted 639
6 SASI_Mm01_00075888 predicted 870
7 SASI_Mm01_00075889 predicted 881
8 SASI_Mm01_00075890 predicted 868
9 SASI_Mm01_00075891 predicted 840
10 SASI_Mm01_00075892 predicted 779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181575
AUP1 MISSION shRNA Bacterial Glycerol Stock
ancient ubiquitous protein 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000297342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-1322s21c1
Sequence:CCGGTCAGCCAACAGCCCTAACATTCTCGAGAATGTTAGGGCTGTTGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-1011s21c1
Sequence:CCGGGCAGAGCACATGAAGCGACAACTCGAGTTGTCGCTTCATGTGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-1384s21c1
Sequence:CCGGGCAAGCAAGCACTATATGAATCTCGAGATTCATATAGTGCTTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-510s21c1
Sequence:CCGGACACCTTTCGACCACAACATACTCGAGTATGTTGTGGTCGAAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181575
AUP1 MISSION shRNA shRNA Plasmid DNA
ancient ubiquitous protein 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000297342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-1322s21c1
Sequence:CCGGTCAGCCAACAGCCCTAACATTCTCGAGAATGTTAGGGCTGTTGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-1011s21c1
Sequence:CCGGGCAGAGCACATGAAGCGACAACTCGAGTTGTCGCTTCATGTGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-1384s21c1
Sequence:CCGGGCAAGCAAGCACTATATGAATCTCGAGATTCATATAGTGCTTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-510s21c1
Sequence:CCGGACACCTTTCGACCACAACATACTCGAGTATGTTGTGGTCGAAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181575
AUP1 MISSION shRNA Lentiviral Transduction Particles
ancient ubiquitous protein 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000297342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-1322s21c1
Sequence:CCGGTCAGCCAACAGCCCTAACATTCTCGAGAATGTTAGGGCTGTTGGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-1011s21c1
Sequence:CCGGGCAGAGCACATGAAGCGACAACTCGAGTTGTCGCTTCATGTGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-1384s21c1
Sequence:CCGGGCAAGCAAGCACTATATGAATCTCGAGATTCATATAGTGCTTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181575.3-510s21c1
Sequence:CCGGACACCTTTCGACCACAACATACTCGAGTATGTTGTGGTCGAAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007517
VALIDATED
AUP1 MISSION shRNA Bacterial Glycerol Stock
ancient ubiquitous protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-1297s21c1
Sequence:CCGGCAAGCAGGCACTGTATGAATACTCGAGTATTCATACAGTGCCTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-647s21c1
Sequence:CCGGCGTTTCAGTTCGTGGCCATTTCTCGAGAAATGGCCACGAACTGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-390s21c1
Sequence:CCGGACCGCGTCAGGGTCCTTATTTCTCGAGAAATAAGGACCCTGACGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-774s21c1
Sequence:CCGGTTGTTCCTTTCACGGTGTATCCTCGAGGATACACCGTGAAAGGAACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-925s21c1
Sequence:CCGGAGAACACATGAAGCGACAAAGCTCGAGCTTTGTCGCTTCATGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007517
VALIDATED
AUP1 MISSION shRNA shRNA Plasmid DNA
ancient ubiquitous protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-1297s21c1
Sequence:CCGGCAAGCAGGCACTGTATGAATACTCGAGTATTCATACAGTGCCTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-647s21c1
Sequence:CCGGCGTTTCAGTTCGTGGCCATTTCTCGAGAAATGGCCACGAACTGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-390s21c1
Sequence:CCGGACCGCGTCAGGGTCCTTATTTCTCGAGAAATAAGGACCCTGACGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-774s21c1
Sequence:CCGGTTGTTCCTTTCACGGTGTATCCTCGAGGATACACCGTGAAAGGAACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-925s21c1
Sequence:CCGGAGAACACATGAAGCGACAAAGCTCGAGCTTTGTCGCTTCATGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007517
VALIDATED
AUP1 MISSION shRNA Lentiviral Transduction Particles
ancient ubiquitous protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-1297s21c1
Sequence:CCGGCAAGCAGGCACTGTATGAATACTCGAGTATTCATACAGTGCCTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-647s21c1
Sequence:CCGGCGTTTCAGTTCGTGGCCATTTCTCGAGAAATGGCCACGAACTGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-390s21c1
Sequence:CCGGACCGCGTCAGGGTCCTTATTTCTCGAGAAATAAGGACCCTGACGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-774s21c1
Sequence:CCGGTTGTTCCTTTCACGGTGTATCCTCGAGGATACACCGTGAAAGGAACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007517.3-925s21c1
Sequence:CCGGAGAACACATGAAGCGACAAAGCTCGAGCTTTGTCGCTTCATGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012103
VALIDATED
AUP1 MISSION shRNA Bacterial Glycerol Stock
ancient ubiquitous protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012103.x-1433s1c1
Sequence:CCGGTCAGCCAACAGCCCTAACATTCTCGAGAATGTTAGGGCTGTTGGCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012103.x-423s1c1
Sequence:CCGGACACCTTTCGACCACAACATACTCGAGTATGTTGTGGTCGAAAGGTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012103.x-1495s1c1
Sequence:CCGGGCAAGCAAGCACTATATGAATCTCGAGATTCATATAGTGCTTGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012103.x-1122s1c1
Sequence:CCGGGCAGAGCACATGAAGCGACAACTCGAGTTGTCGCTTCATGTGCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012103.x-1612s1c1
Sequence:CCGGCAGCCCTCACCCAACTCACAACTCGAGTTGTGAGTTGGGTGAGGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012103
VALIDATED
AUP1 MISSION shRNA shRNA Plasmid DNA
ancient ubiquitous protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012103.x-1433s1c1
Sequence:CCGGTCAGCCAACAGCCCTAACATTCTCGAGAATGTTAGGGCTGTTGGCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012103.x-423s1c1
Sequence:CCGGACACCTTTCGACCACAACATACTCGAGTATGTTGTGGTCGAAAGGTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012103.x-1495s1c1
Sequence:CCGGGCAAGCAAGCACTATATGAATCTCGAGATTCATATAGTGCTTGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012103.x-1122s1c1
Sequence:CCGGGCAGAGCACATGAAGCGACAACTCGAGTTGTCGCTTCATGTGCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012103.x-1612s1c1
Sequence:CCGGCAGCCCTCACCCAACTCACAACTCGAGTTGTGAGTTGGGTGAGGGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012103
VALIDATED
AUP1 MISSION shRNA Lentiviral Transduction Particles
ancient ubiquitous protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012103.x-1433s1c1
Sequence:CCGGTCAGCCAACAGCCCTAACATTCTCGAGAATGTTAGGGCTGTTGGCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012103.x-423s1c1
Sequence:CCGGACACCTTTCGACCACAACATACTCGAGTATGTTGTGGTCGAAAGGTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012103.x-1495s1c1
Sequence:CCGGGCAAGCAAGCACTATATGAATCTCGAGATTCATATAGTGCTTGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012103.x-1122s1c1
Sequence:CCGGGCAGAGCACATGAAGCGACAACTCGAGTTGTCGCTTCATGTGCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012103.x-1612s1c1
Sequence:CCGGCAGCCCTCACCCAACTCACAACTCGAGTTGTGAGTTGGGTGAGGGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)