EMAIL THIS PAGE TO A FRIEND

AURKA

aurora kinase A

142 Gene Product Result for
Synonyms: AIK ARK1 AURA AURORA2 BTAK PPP1R47 STK15 STK6 STK7
UniProtKB ID: O14965, E1P5F9, O60445, O75873, Q9BQD6, Q9UPG5
Gene ID:
Human(6790) Summary: The protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20878) aurora kinase A
Rat(261730) aurora kinase A
Zebrafish(445246) aurora kinase A
cow(504437) aurora kinase A
domestic cat(101091184) aurora kinase A
dog(485940) aurora kinase A
chicken(428167) aurora kinase A
sheep(100216431) aurora kinase A
naked mole-rat(101724489) aurora kinase A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306395 ANTI-AIK(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4502887 Anti-AURA, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
HPA002636 Anti-AURKA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100190 Anti-AURKA antibody produced in rabbit affinity isolated antibody human, bovine
western blot pricing
SAB2500135 Anti-Aurora Kinase A/AURKA antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB5500010 Anti-Aurora Kinase A/B/C antibody, Rabbit monoclonal clone SP201, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB4502886 Anti-Aurora Kinase antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
A1231 Anti-Aurora-A Kinase antibody, Mouse monoclonal clone 35C1, purified from hybridoma cell culture mouse, human
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB1306171 ANTI-AURORA-A(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunofluorescence, western blot pricing
SAB4504273 Anti-phospho-AurA (pSer342) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4300270 Anti-phospho-AURKA (pThr288) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry pricing
SAB4503898 Anti-phospho-Aurora Kinase (pThr288) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB5300335 Monoclonal Anti-AURKA antibody produced in mouse clone 1F8, ascites fluid monkey, human, rat
ELISA, flow cytometry, immunofluorescence, western blot pricing
SAB5300336 Monoclonal Anti-AURKA antibody produced in mouse clone 4G10, ascites fluid rat, monkey, human
ELISA, immunohistochemistry, western blot pricing
SAB4200444 Monoclonal Anti-Aurka/Aurora-A Kinase antibody produced in mouse ~1.0 mg/mL, clone AR-7, purified immunoglobulin human
immunofluorescence, western blot pricing
A2606 Monoclonal Anti-Aurora-A Kinase−Biotin antibody produced in mouse ~2 mg/mL, clone 35C1, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, western blot pricing
WH0006790M1 Monoclonal Anti-STK6 antibody produced in mouse clone 5F8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0024 AQUA Peptide FGNVYLA[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing
AQ0022 AQUA Peptide LYGYFHDAT[R] cow, dog, human, mouse, pig, rat pricing
AQ0023 AQUA Peptide VPLQAQ[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_130737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003600 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU028351 MISSION® esiRNA esiRNA targeting mouse Aurka (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003600 Rosetta Predictions human pricing
NM_198433 Rosetta Predictions human pricing
NM_198434 Rosetta Predictions human pricing
NM_198435 Rosetta Predictions human pricing
NM_198436 Rosetta Predictions human pricing
NM_198437 Rosetta Predictions human pricing
NM_153296 Rosetta Predictions rat pricing
NM_011497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079240 predicted 1251
2 SASI_Hs01_00079241 predicted 1041
3 SASI_Hs01_00079242 predicted 813
4 SASI_Hs01_00079243 predicted 1391
5 SASI_Hs01_00079244 predicted 1541
6 SASI_Hs01_00079245 predicted 1105
7 SASI_Hs01_00079246 predicted 1369
8 SASI_Hs01_00079248 predicted 1097
9 SASI_Hs02_00335932 predicted 1091
10 SASI_Hs01_00079249 predicted 1604
11 SASI_Hs01_00079247 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241476 predicted 1465
2 SASI_Hs01_00241477 predicted 1249
3 SASI_Hs01_00241478 predicted 1023
4 SASI_Hs01_00241479 predicted 1601
5 SASI_Hs01_00241480 predicted 1750
6 SASI_Hs01_00241481 predicted 1310
7 SASI_Hs01_00241482 predicted 1577
8 SASI_Hs01_00241484 predicted 1304
9 SASI_Hs02_00371943 predicted 1294
10 SASI_Hs01_00241485 predicted 1807
11 SASI_Hs01_00241483 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149237 predicted 1156
2 SASI_Hs01_00149238 predicted 942
3 SASI_Hs01_00149239 predicted 717
4 SASI_Hs01_00149240 predicted 1290
5 SASI_Hs01_00149241 predicted 1438
6 SASI_Hs01_00149242 predicted 1008
7 SASI_Hs01_00149243 predicted 1271
8 SASI_Hs01_00149245 predicted 988
9 SASI_Hs02_00371944 predicted 987
10 SASI_Hs01_00149246 predicted 1502
11 SASI_Hs01_00149244 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100966 predicted 1040
2 SASI_Hs01_00100967 predicted 835
3 SASI_Hs01_00100968 predicted 601
4 SASI_Hs01_00100969 predicted 1176
5 SASI_Hs01_00100970 predicted 1331
6 SASI_Hs01_00100971 predicted 894
7 SASI_Hs01_00100972 predicted 1159
8 SASI_Hs01_00100974 predicted 883
9 SASI_Hs02_00371945 predicted 878
10 SASI_Hs01_00100975 predicted 1396
11 SASI_Hs01_00100973 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185874 predicted 1140
2 SASI_Hs01_00185875 predicted 926
3 SASI_Hs01_00185876 predicted 699
4 SASI_Hs01_00185877 predicted 1271
5 SASI_Hs01_00185878 predicted 1428
6 SASI_Hs01_00185879 predicted 990
7 SASI_Hs01_00185880 predicted 1252
8 SASI_Hs01_00185882 predicted 977
9 SASI_Hs02_00371946 predicted 971
10 SASI_Hs01_00185883 predicted 1487
11 SASI_Hs01_00185881 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142821 predicted 1027
2 SASI_Hs01_00142822 predicted 824
3 SASI_Hs01_00142823 predicted 594
4 SASI_Hs01_00142824 predicted 1165
5 SASI_Hs01_00142825 predicted 1320
6 SASI_Hs01_00142826 predicted 875
7 SASI_Hs01_00142827 predicted 1143
8 SASI_Hs01_00142829 predicted 864
9 SASI_Hs02_00371947 predicted 861
10 SASI_Hs01_00142830 predicted 1380
11 SASI_Hs01_00142828 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111720 predicted 1696
2 SASI_Rn01_00111721 predicted 1454
3 SASI_Rn01_00111722 predicted 1089
4 SASI_Rn01_00111723 predicted 713
5 SASI_Rn02_00268941 predicted 1595
6 SASI_Rn01_00111724 predicted 1005
7 SASI_Rn01_00111725 predicted 675
8 SASI_Rn01_00111726 predicted 1599
9 SASI_Rn01_00111727 predicted 1206
10 SASI_Rn01_00111728 predicted 1534
11 SASI_Rn01_00111729 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194885 predicted 1160
2 SASI_Mm02_00320802 predicted 1278
3 SASI_Mm02_00320803 predicted 793
4 SASI_Mm01_00194888 predicted 773
5 SASI_Mm02_00320804 predicted 1181
6 SASI_Mm01_00194889 predicted 888
7 SASI_Mm02_00320805 predicted 1230
8 SASI_Mm02_00320806 predicted 703
9 SASI_Mm01_00194892 predicted 788
10 SASI_Mm02_00320807 predicted 215
11 SASI_Mm01_00194886 predicted 1106
12 SASI_Mm01_00194887 predicted 1291
13 SASI_Mm01_00194890 predicted 822
14 SASI_Mm01_00194891 predicted 678
15 SASI_Mm01_00194893 predicted 873
16 SASI_Mm01_00194894 predicted 1273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130737
VALIDATED
AURKA MISSION shRNA Bacterial Glycerol Stock
aurora kinase A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000025139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130737.2-1163s1c1
Sequence:CCGGCCTCATTTCAAGACTGTTAAACTCGAGTTTAACAGTCTTGAAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130737.2-668s1c1
Sequence:CCGGCCTCAGGCTGTATGGCTATTTCTCGAGAAATAGCCATACAGCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130737.2-467s1c1
Sequence:CCGGGCAGTGGACTTTGGAAGATTTCTCGAGAAATCTTCCAAAGTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130737.2-1226s1c1
Sequence:CCGGGCACCCTTGGATCAAAGCTAACTCGAGTTAGCTTTGATCCAAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130737
VALIDATED
AURKA MISSION shRNA shRNA Plasmid DNA
aurora kinase A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000025139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130737.2-1163s1c1
Sequence:CCGGCCTCATTTCAAGACTGTTAAACTCGAGTTTAACAGTCTTGAAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130737.2-668s1c1
Sequence:CCGGCCTCAGGCTGTATGGCTATTTCTCGAGAAATAGCCATACAGCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130737.2-467s1c1
Sequence:CCGGGCAGTGGACTTTGGAAGATTTCTCGAGAAATCTTCCAAAGTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130737.2-1226s1c1
Sequence:CCGGGCACCCTTGGATCAAAGCTAACTCGAGTTAGCTTTGATCCAAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130737
VALIDATED
AURKA MISSION shRNA Lentiviral Transduction Particles
aurora kinase A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000025139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130737.2-1163s1c1
Sequence:CCGGCCTCATTTCAAGACTGTTAAACTCGAGTTTAACAGTCTTGAAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130737.2-668s1c1
Sequence:CCGGCCTCAGGCTGTATGGCTATTTCTCGAGAAATAGCCATACAGCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130737.2-467s1c1
Sequence:CCGGGCAGTGGACTTTGGAAGATTTCTCGAGAAATCTTCCAAAGTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130737.2-1226s1c1
Sequence:CCGGGCACCCTTGGATCAAAGCTAACTCGAGTTAGCTTTGATCCAAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003600
VALIDATED
AURKA MISSION shRNA Bacterial Glycerol Stock
aurora kinase A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-1252s1c1
Sequence:CCGGCACATACCAAGAGACCTACAACTCGAGTTGTAGGTCTCTTGGTATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003600.x-524s1c1
Sequence:CCGGAGGCCACTGAATAACACCCAACTCGAGTTGGGTGTTATTCAGTGGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-870s1c1
Sequence:CCGGGAGTCTACCTAATTCTGGAATCTCGAGATTCCAGAATTAGGTAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-985s1c1
Sequence:CCGGCCTGTCTTACTGTCATTCGAACTCGAGTTCGAATGACAGTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-1676s1c1
Sequence:CCGGACGAGAATTGTGCTACTTATACTCGAGTATAAGTAGCACAATTCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003600.2-387s1c1
Sequence:CCGGCAGGACCTGTTAAGGCTACAGCTCGAGCTGTAGCCTTAACAGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003600.2-1048s1c1
Sequence:CCGGGCAGAGAACTGCTACTTATATCTCGAGATATAAGTAGCAGTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003600.2-524s1c1
Sequence:CCGGCGCATTCCTTTGCAAGCACAACTCGAGTTGTGCTTGCAAAGGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003600.2-458s1c1
Sequence:CCGGCAGAATCCATTACCTGTAAATCTCGAGATTTACAGGTAATGGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003600.2-914s21c1
Sequence:CCGGTCCCACCTTCGGCATCCTAATCTCGAGATTAGGATGCCGAAGGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003600.2-834s21c1
Sequence:CCGGTGGCTCTTAAAGTGTTATTTACTCGAGTAAATAACACTTTAAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003600
VALIDATED
AURKA MISSION shRNA shRNA Plasmid DNA
aurora kinase A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-1252s1c1
Sequence:CCGGCACATACCAAGAGACCTACAACTCGAGTTGTAGGTCTCTTGGTATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003600.x-524s1c1
Sequence:CCGGAGGCCACTGAATAACACCCAACTCGAGTTGGGTGTTATTCAGTGGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-870s1c1
Sequence:CCGGGAGTCTACCTAATTCTGGAATCTCGAGATTCCAGAATTAGGTAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-985s1c1
Sequence:CCGGCCTGTCTTACTGTCATTCGAACTCGAGTTCGAATGACAGTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-1676s1c1
Sequence:CCGGACGAGAATTGTGCTACTTATACTCGAGTATAAGTAGCACAATTCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003600.2-387s1c1
Sequence:CCGGCAGGACCTGTTAAGGCTACAGCTCGAGCTGTAGCCTTAACAGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003600.2-1048s1c1
Sequence:CCGGGCAGAGAACTGCTACTTATATCTCGAGATATAAGTAGCAGTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003600.2-524s1c1
Sequence:CCGGCGCATTCCTTTGCAAGCACAACTCGAGTTGTGCTTGCAAAGGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003600.2-458s1c1
Sequence:CCGGCAGAATCCATTACCTGTAAATCTCGAGATTTACAGGTAATGGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003600.2-914s21c1
Sequence:CCGGTCCCACCTTCGGCATCCTAATCTCGAGATTAGGATGCCGAAGGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003600.2-834s21c1
Sequence:CCGGTGGCTCTTAAAGTGTTATTTACTCGAGTAAATAACACTTTAAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003600
VALIDATED
AURKA MISSION shRNA Lentiviral Transduction Particles
aurora kinase A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-1252s1c1
Sequence:CCGGCACATACCAAGAGACCTACAACTCGAGTTGTAGGTCTCTTGGTATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003600.x-524s1c1
Sequence:CCGGAGGCCACTGAATAACACCCAACTCGAGTTGGGTGTTATTCAGTGGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-870s1c1
Sequence:CCGGGAGTCTACCTAATTCTGGAATCTCGAGATTCCAGAATTAGGTAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-985s1c1
Sequence:CCGGCCTGTCTTACTGTCATTCGAACTCGAGTTCGAATGACAGTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003600.x-1676s1c1
Sequence:CCGGACGAGAATTGTGCTACTTATACTCGAGTATAAGTAGCACAATTCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003600.2-387s1c1
Sequence:CCGGCAGGACCTGTTAAGGCTACAGCTCGAGCTGTAGCCTTAACAGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003600.2-1048s1c1
Sequence:CCGGGCAGAGAACTGCTACTTATATCTCGAGATATAAGTAGCAGTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003600.2-524s1c1
Sequence:CCGGCGCATTCCTTTGCAAGCACAACTCGAGTTGTGCTTGCAAAGGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003600.2-458s1c1
Sequence:CCGGCAGAATCCATTACCTGTAAATCTCGAGATTTACAGGTAATGGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003600.2-914s21c1
Sequence:CCGGTCCCACCTTCGGCATCCTAATCTCGAGATTAGGATGCCGAAGGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003600.2-834s21c1
Sequence:CCGGTGGCTCTTAAAGTGTTATTTACTCGAGTAAATAACACTTTAAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011497
AURKA MISSION shRNA Bacterial Glycerol Stock
aurora kinase A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000280474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-1164s21c1
Sequence:CCGGCCTCATTTCAAGACTGTTAAACTCGAGTTTAACAGTCTTGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-1227s21c1
Sequence:CCGGGCACCCTTGGATCAAAGCTAACTCGAGTTAGCTTTGATCCAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-669s21c1
Sequence:CCGGCCTCAGGCTGTATGGCTATTTCTCGAGAAATAGCCATACAGCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-468s21c1
Sequence:CCGGGCAGTGGACTTTGGAAGATTTCTCGAGAAATCTTCCAAAGTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011497
AURKA MISSION shRNA shRNA Plasmid DNA
aurora kinase A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000280474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-1164s21c1
Sequence:CCGGCCTCATTTCAAGACTGTTAAACTCGAGTTTAACAGTCTTGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-1227s21c1
Sequence:CCGGGCACCCTTGGATCAAAGCTAACTCGAGTTAGCTTTGATCCAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-669s21c1
Sequence:CCGGCCTCAGGCTGTATGGCTATTTCTCGAGAAATAGCCATACAGCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-468s21c1
Sequence:CCGGGCAGTGGACTTTGGAAGATTTCTCGAGAAATCTTCCAAAGTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011497
AURKA MISSION shRNA Lentiviral Transduction Particles
aurora kinase A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000280474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-1164s21c1
Sequence:CCGGCCTCATTTCAAGACTGTTAAACTCGAGTTTAACAGTCTTGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-1227s21c1
Sequence:CCGGGCACCCTTGGATCAAAGCTAACTCGAGTTAGCTTTGATCCAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-669s21c1
Sequence:CCGGCCTCAGGCTGTATGGCTATTTCTCGAGAAATAGCCATACAGCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011497.3-468s21c1
Sequence:CCGGGCAGTGGACTTTGGAAGATTTCTCGAGAAATCTTCCAAAGTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks