EMAIL THIS PAGE TO A FRIEND

AURKAIP1

aurora kinase A interacting protein 1

68 Gene Product Result for
Synonyms: AIP AKIP
UniProtKB ID: Q9NWT8, Q5TA36, Q8TBD3
Gene ID:
Mouse(66077) aurora kinase A interacting protein 1
Rat(298687) aurora kinase A interacting protein 1
naked mole-rat(101712942) aurora kinase A interacting protein 1
domestic guinea pig(100728184) aurora kinase A interacting protein 1
sheep(101106608) aurora kinase A interacting protein 1
Zebrafish(100126015) aurora kinase A interacting protein 1
chicken(419415) aurora kinase A interacting protein 1
cow(506359) aurora kinase A interacting protein 1
domestic cat(101080697) aurora kinase A interacting protein 1
dog(607067) aurora kinase A interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025338 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025338 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025338 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017900 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081251 MISSION® esiRNA esiRNA targeting mouse Aurkaip1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127229 Rosetta Predictions human pricing
NM_001127230 Rosetta Predictions human pricing
NM_017900 Rosetta Predictions human pricing
NM_001004237 Rosetta Predictions rat pricing
NM_025338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328937 predicted 594
2 SASI_Hs02_00328938 predicted 600
3 SASI_Hs02_00328939 predicted 638
4 SASI_Hs02_00328940 predicted 589
5 SASI_Hs02_00328941 predicted 681
6 SASI_Hs02_00328942 predicted 589
7 SASI_Hs02_00328943 predicted 600
8 SASI_Hs02_00328944 predicted 515
9 SASI_Hs02_00328945 predicted 581
10 SASI_Hs02_00328946 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328947 predicted 489
2 SASI_Hs02_00328948 predicted 498
3 SASI_Hs02_00328949 predicted 544
4 SASI_Hs02_00328950 predicted 488
5 SASI_Hs02_00328951 predicted 589
6 SASI_Hs02_00328952 predicted 491
7 SASI_Hs02_00328953 predicted 499
8 SASI_Hs02_00328954 predicted 414
9 SASI_Hs02_00328955 predicted 492
10 SASI_Hs02_00328956 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244284 predicted 666
2 SASI_Hs01_00244285 predicted 681
3 SASI_Hs01_00244286 predicted 719
4 SASI_Hs01_00244287 predicted 664
5 SASI_Hs01_00244288 predicted 763
6 SASI_Hs01_00244289 predicted 675
7 SASI_Hs01_00244290 predicted 680
8 SASI_Hs01_00244291 predicted 597
9 SASI_Hs01_00244292 predicted 671
10 SASI_Hs01_00244293 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053099 predicted 538
2 SASI_Rn01_00053100 predicted 520
3 SASI_Rn02_00198241 predicted 250
4 SASI_Rn01_00053101 predicted 312
5 SASI_Rn01_00053103 predicted 474
6 SASI_Rn01_00053105 predicted 255
7 SASI_Rn01_00053106 predicted 502
8 SASI_Rn01_00053107 predicted 502
9 SASI_Rn02_00198242 predicted 287
10 SASI_Rn02_00198243 predicted 533
11 SASI_Rn01_00053098 predicted 259
12 SASI_Rn01_00053102 predicted 437
13 SASI_Rn01_00053104 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124249 predicted 529
2 SASI_Mm01_00124253 predicted 539
3 SASI_Mm02_00327996 predicted 540
4 SASI_Mm02_00327997 predicted 515
5 SASI_Mm02_00327998 predicted 530
6 SASI_Mm01_00124250 predicted 355
7 SASI_Mm01_00124251 predicted 509
8 SASI_Mm01_00124252 predicted 351
9 SASI_Mm02_00327999 predicted 288
10 SASI_Mm01_00124255 predicted 331
11 SASI_Mm01_00124254 predicted 521
12 SASI_Mm01_00124256 predicted 210
13 SASI_Mm01_00124257 predicted 362
14 SASI_Mm01_00124258 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025338
VALIDATED
AURKAIP1 MISSION shRNA Bacterial Glycerol Stock
aurora kinase A interacting protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025338.3-207s21c1
Sequence:CCGGGGTGATTGGCAGCTATGCTTTCTCGAGAAAGCATAGCTGCCAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025338.3-540s21c1
Sequence:CCGGGAACCACCACAAGTACCGTAACTCGAGTTACGGTACTTGTGGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025338.3-516s21c1
Sequence:CCGGGCTGAAGATCCGAAGGCGAAACTCGAGTTTCGCCTTCGGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025338.3-357s21c1
Sequence:CCGGGCTGACTGCTCAATACTTATTCTCGAGAATAAGTATTGAGCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025338.3-614s21c1
Sequence:CCGGAGAAGAAGCAGATCAAATTTGCTCGAGCAAATTTGATCTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-365s1c1
Sequence:CCGGGCTCAATACTTATTGCCCAGACTCGAGTCTGGGCAATAAGTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-358s1c1
Sequence:CCGGGCTGACTGCTCAATACTTATTCTCGAGAATAAGTATTGAGCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025338.1-423s1c1
Sequence:CCGGAGTTCTACGAATGTCCACCTACTCGAGTAGGTGGACATTCGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-517s1c1
Sequence:CCGGGCTGAAGATCCGAAGGCGAAACTCGAGTTTCGCCTTCGGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-541s1c1
Sequence:CCGGGAACCACCACAAGTACCGTAACTCGAGTTACGGTACTTGTGGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025338
VALIDATED
AURKAIP1 MISSION shRNA shRNA Plasmid DNA
aurora kinase A interacting protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025338.3-207s21c1
Sequence:CCGGGGTGATTGGCAGCTATGCTTTCTCGAGAAAGCATAGCTGCCAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025338.3-540s21c1
Sequence:CCGGGAACCACCACAAGTACCGTAACTCGAGTTACGGTACTTGTGGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025338.3-516s21c1
Sequence:CCGGGCTGAAGATCCGAAGGCGAAACTCGAGTTTCGCCTTCGGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025338.3-357s21c1
Sequence:CCGGGCTGACTGCTCAATACTTATTCTCGAGAATAAGTATTGAGCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025338.3-614s21c1
Sequence:CCGGAGAAGAAGCAGATCAAATTTGCTCGAGCAAATTTGATCTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-365s1c1
Sequence:CCGGGCTCAATACTTATTGCCCAGACTCGAGTCTGGGCAATAAGTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-358s1c1
Sequence:CCGGGCTGACTGCTCAATACTTATTCTCGAGAATAAGTATTGAGCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025338.1-423s1c1
Sequence:CCGGAGTTCTACGAATGTCCACCTACTCGAGTAGGTGGACATTCGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-517s1c1
Sequence:CCGGGCTGAAGATCCGAAGGCGAAACTCGAGTTTCGCCTTCGGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-541s1c1
Sequence:CCGGGAACCACCACAAGTACCGTAACTCGAGTTACGGTACTTGTGGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025338
VALIDATED
AURKAIP1 MISSION shRNA Lentiviral Transduction Particles
aurora kinase A interacting protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025338.3-207s21c1
Sequence:CCGGGGTGATTGGCAGCTATGCTTTCTCGAGAAAGCATAGCTGCCAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025338.3-540s21c1
Sequence:CCGGGAACCACCACAAGTACCGTAACTCGAGTTACGGTACTTGTGGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025338.3-516s21c1
Sequence:CCGGGCTGAAGATCCGAAGGCGAAACTCGAGTTTCGCCTTCGGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025338.3-357s21c1
Sequence:CCGGGCTGACTGCTCAATACTTATTCTCGAGAATAAGTATTGAGCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025338.3-614s21c1
Sequence:CCGGAGAAGAAGCAGATCAAATTTGCTCGAGCAAATTTGATCTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-365s1c1
Sequence:CCGGGCTCAATACTTATTGCCCAGACTCGAGTCTGGGCAATAAGTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-358s1c1
Sequence:CCGGGCTGACTGCTCAATACTTATTCTCGAGAATAAGTATTGAGCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025338.1-423s1c1
Sequence:CCGGAGTTCTACGAATGTCCACCTACTCGAGTAGGTGGACATTCGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-517s1c1
Sequence:CCGGGCTGAAGATCCGAAGGCGAAACTCGAGTTTCGCCTTCGGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025338.1-541s1c1
Sequence:CCGGGAACCACCACAAGTACCGTAACTCGAGTTACGGTACTTGTGGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017900
VALIDATED
AURKAIP1 MISSION shRNA Bacterial Glycerol Stock
aurora kinase A interacting protein 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000037579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017900.1-445s1c1
Sequence:CCGGGCGCCTCAAATTCAGTGCAAACTCGAGTTTGCACTGAATTTGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017900.1-370s1c1
Sequence:CCGGCCACCGCAATCCTACCAGTGTCTCGAGACACTGGTAGGATTGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017900.1-498s1c1
Sequence:CCGGCCACCACAAGTACCGGAAGCTCTCGAGAGCTTCCGGTACTTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017900.1-567s1c1
Sequence:CCGGGAGACGCAAGCAGATCAAGTTCTCGAGAACTTGATCTGCTTGCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017900
VALIDATED
AURKAIP1 MISSION shRNA shRNA Plasmid DNA
aurora kinase A interacting protein 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000037579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017900.1-445s1c1
Sequence:CCGGGCGCCTCAAATTCAGTGCAAACTCGAGTTTGCACTGAATTTGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017900.1-370s1c1
Sequence:CCGGCCACCGCAATCCTACCAGTGTCTCGAGACACTGGTAGGATTGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017900.1-498s1c1
Sequence:CCGGCCACCACAAGTACCGGAAGCTCTCGAGAGCTTCCGGTACTTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017900.1-567s1c1
Sequence:CCGGGAGACGCAAGCAGATCAAGTTCTCGAGAACTTGATCTGCTTGCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017900
VALIDATED
AURKAIP1 MISSION shRNA Lentiviral Transduction Particles
aurora kinase A interacting protein 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000037579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017900.1-445s1c1
Sequence:CCGGGCGCCTCAAATTCAGTGCAAACTCGAGTTTGCACTGAATTTGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017900.1-370s1c1
Sequence:CCGGCCACCGCAATCCTACCAGTGTCTCGAGACACTGGTAGGATTGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017900.1-498s1c1
Sequence:CCGGCCACCACAAGTACCGGAAGCTCTCGAGAGCTTCCGGTACTTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017900.1-567s1c1
Sequence:CCGGGAGACGCAAGCAGATCAAGTTCTCGAGAACTTGATCTGCTTGCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks