EMAIL THIS PAGE TO A FRIEND

AURKB

aurora kinase B

77 Gene Product Result for
Synonyms: AIK2 AIM-1 AIM1 ARK2 AurB IPL1 PPP1R48 STK12 STK5 aurkb-sv1 aurkb-sv2
Gene ID:
Human(9212) Summary: This gene encodes a member of the aurora kinase subfamily of serine/threonine kinases. The genes encoding the other two members of this subfamily are located on chromosomes 19 and 20. These kinases participate in the regulation of segregation of chromosomes during mitosis and meiosis through association with microtubules. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Mouse(20877) aurora kinase B
Rat(114592) aurora kinase B
Zebrafish(791894) aurora kinase B
cow(360192) aurora kinase B
domestic cat(101081264) aurora kinase B
dog(479492) aurora kinase B
sheep(101106860) aurora kinase B
naked mole-rat(101713391) aurora kinase B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502891 Anti-AURB antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4503586 Anti-AURB antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, western blot pricing
SAB4503587 Anti-AURB, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA037708 Anti-AURKB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
A5102 Anti-Aurora B antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human, rat
immunofluorescence, immunoprecipitation, microarray, western blot pricing
SAB1306365 ANTI-AURORA-B (ARK/STK12) (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1306364 ANTI-AURORA-B (ARK/STK12)(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, primate, mouse
immunohistochemistry, western blot pricing
SAB1304707 ANTI-MOUSE AURKB (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4504219 Anti-phospho-AurB (pThr232) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301479 Anti-phospho-AurB (pThr232) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4504274 Anti-phospho-AurB (pTyr12) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
WH0009212M3 Monoclonal Anti-AURKB antibody produced in mouse clone 6H7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300517 Monoclonal Anti-AURKB antibody produced in mouse clone 13E8D3, ascites fluid human
ELISA, western blot pricing
SAB1404685 Monoclonal Anti-AURKB, (N-terminal) antibody produced in mouse clone 6G8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0024 AQUA Peptide FGNVYLA[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing
AQ0025 AQUA Peptide DIKPENLLLGL[K] human pricing
AQ0026 AQUA Peptide SNVQPTAAPGQ[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004217 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_181344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_181344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_181344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_011496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004217 siRNAs that have been validated in the lab human pricing
NM_053749 Rosetta Predictions rat pricing
NM_011496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004217 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076963 validated 684
2 SASI_Hs01_00076962 predicted 314
3 SASI_Hs01_00076964 predicted 352
4 SASI_Hs01_00076965 predicted 261
5 SASI_Hs01_00076966 predicted 272
6 SASI_Hs01_00076967 predicted 868
7 SASI_Hs01_00076968 predicted 552
8 SASI_Hs01_00076969 predicted 504
9 SASI_Hs02_00337127 predicted 351
10 SASI_Hs01_00076970 predicted 503
11 SASI_Hs01_00076971 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046794 predicted 487
2 SASI_Rn02_00266534 predicted 337
3 SASI_Rn01_00046795 predicted 442
4 SASI_Rn01_00046796 predicted 810
5 SASI_Rn01_00046797 predicted 1031
6 SASI_Rn01_00046798 predicted 587
7 SASI_Rn01_00046799 predicted 1203
8 SASI_Rn01_00046800 predicted 928
9 SASI_Rn01_00046801 predicted 301
10 SASI_Rn01_00046802 predicted 502
11 SASI_Rn01_00046803 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056605 predicted 917
2 SASI_Mm01_00056606 predicted 728
3 SASI_Mm01_00056608 predicted 532
4 SASI_Mm01_00056609 predicted 626
5 SASI_Mm01_00056610 predicted 628
6 SASI_Mm01_00056611 predicted 581
7 SASI_Mm01_00056612 predicted 778
8 SASI_Mm01_00056613 predicted 317
9 SASI_Mm01_00056614 predicted 915
10 SASI_Mm02_00320801 predicted 1433
11 SASI_Mm01_00056607 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004217
VALIDATED
AURKB MISSION shRNA Bacterial Glycerol Stock
aurora kinase B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004217.x-883s1c1
Sequence:CCGGGCATCACACAACGAGACCTATCTCGAGATAGGTCTCGTTGTGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004217.x-227s1c1
Sequence:CCGGTGATGGAGAATAGCAGTGGGACTCGAGTCCCACTGCTATTCTCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004217.x-468s1c1
Sequence:CCGGCCTGCGTCTCTACAACTATTTCTCGAGAAATAGTTGTAGAGACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-167s1c1
Sequence:CCGGCCATCTGCACTTGTCCTCATGCTCGAGCATGAGGACAAGTGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-137s1c1
Sequence:CCGGCAGCGAGTCCTCCGGAAAGAGCTCGAGCTCTTTCCGGAGGACTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-913s1c1
Sequence:CCGGCATCGTCAAGGTGGACCTAAACTCGAGTTTAGGTCCACCTTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-562s21c1
Sequence:CCGGGAAGAGCTGCACATTTGACGACTCGAGTCGTCAAATGTGCAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-137s21c1
Sequence:CCGGCAGCGAGTCCTCCGGAAAGAGCTCGAGCTCTTTCCGGAGGACTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004217.2-1189s21c1
Sequence:CCGGCTACCTCCTCCTTTGTTTAATCTCGAGATTAAACAAAGGAGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-263s21c1
Sequence:CCGGTTAACGCGGCACTTCACAATTCTCGAGAATTGTGAAGTGCCGCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-263s1c1
Sequence:CCGGTTAACGCGGCACTTCACAATTCTCGAGAATTGTGAAGTGCCGCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-472s21c1
Sequence:CCGGCCTGCGTCTCTACAACTATTTCTCGAGAAATAGTTGTAGAGACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004217
VALIDATED
AURKB MISSION shRNA shRNA Plasmid DNA
aurora kinase B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004217.x-883s1c1
Sequence:CCGGGCATCACACAACGAGACCTATCTCGAGATAGGTCTCGTTGTGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004217.x-227s1c1
Sequence:CCGGTGATGGAGAATAGCAGTGGGACTCGAGTCCCACTGCTATTCTCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004217.x-468s1c1
Sequence:CCGGCCTGCGTCTCTACAACTATTTCTCGAGAAATAGTTGTAGAGACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-167s1c1
Sequence:CCGGCCATCTGCACTTGTCCTCATGCTCGAGCATGAGGACAAGTGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-137s1c1
Sequence:CCGGCAGCGAGTCCTCCGGAAAGAGCTCGAGCTCTTTCCGGAGGACTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-913s1c1
Sequence:CCGGCATCGTCAAGGTGGACCTAAACTCGAGTTTAGGTCCACCTTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-562s21c1
Sequence:CCGGGAAGAGCTGCACATTTGACGACTCGAGTCGTCAAATGTGCAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-137s21c1
Sequence:CCGGCAGCGAGTCCTCCGGAAAGAGCTCGAGCTCTTTCCGGAGGACTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004217.2-1189s21c1
Sequence:CCGGCTACCTCCTCCTTTGTTTAATCTCGAGATTAAACAAAGGAGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-263s21c1
Sequence:CCGGTTAACGCGGCACTTCACAATTCTCGAGAATTGTGAAGTGCCGCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-263s1c1
Sequence:CCGGTTAACGCGGCACTTCACAATTCTCGAGAATTGTGAAGTGCCGCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-472s21c1
Sequence:CCGGCCTGCGTCTCTACAACTATTTCTCGAGAAATAGTTGTAGAGACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004217
VALIDATED
AURKB MISSION shRNA Lentiviral Transduction Particles
aurora kinase B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004217.x-883s1c1
Sequence:CCGGGCATCACACAACGAGACCTATCTCGAGATAGGTCTCGTTGTGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004217.x-227s1c1
Sequence:CCGGTGATGGAGAATAGCAGTGGGACTCGAGTCCCACTGCTATTCTCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004217.x-468s1c1
Sequence:CCGGCCTGCGTCTCTACAACTATTTCTCGAGAAATAGTTGTAGAGACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-167s1c1
Sequence:CCGGCCATCTGCACTTGTCCTCATGCTCGAGCATGAGGACAAGTGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-137s1c1
Sequence:CCGGCAGCGAGTCCTCCGGAAAGAGCTCGAGCTCTTTCCGGAGGACTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-913s1c1
Sequence:CCGGCATCGTCAAGGTGGACCTAAACTCGAGTTTAGGTCCACCTTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-562s21c1
Sequence:CCGGGAAGAGCTGCACATTTGACGACTCGAGTCGTCAAATGTGCAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-137s21c1
Sequence:CCGGCAGCGAGTCCTCCGGAAAGAGCTCGAGCTCTTTCCGGAGGACTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004217.2-1189s21c1
Sequence:CCGGCTACCTCCTCCTTTGTTTAATCTCGAGATTAAACAAAGGAGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-263s21c1
Sequence:CCGGTTAACGCGGCACTTCACAATTCTCGAGAATTGTGAAGTGCCGCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004217.2-263s1c1
Sequence:CCGGTTAACGCGGCACTTCACAATTCTCGAGAATTGTGAAGTGCCGCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004217.2-472s21c1
Sequence:CCGGCCTGCGTCTCTACAACTATTTCTCGAGAAATAGTTGTAGAGACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_181344
AURKB MISSION shRNA Bacterial Glycerol Stock
aurora kinase B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-1231s1c1
Sequence:CCGGCTCATCTCCAAGCTGCTCAAACTCGAGTTTGAGCAGCTTGGAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-1066s1c1
Sequence:CCGGCGCATGCATAATGAAATGGTACTCGAGTACCATTTCATTATGCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-531s1c1
Sequence:CCGGGCAGCCTTTCACTATTGACAACTCGAGTTGTCAATAGTGAAAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-735s1c1
Sequence:CCGGCCTTCAACTCTACAACTACTTCTCGAGAAGTAGTTGTAGAGTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-762s1c1
Sequence:CCGGCCAGCAGAGGATCTACTTAATCTCGAGATTAAGTAGATCCTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_181344
AURKB MISSION shRNA shRNA Plasmid DNA
aurora kinase B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-1231s1c1
Sequence:CCGGCTCATCTCCAAGCTGCTCAAACTCGAGTTTGAGCAGCTTGGAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-1066s1c1
Sequence:CCGGCGCATGCATAATGAAATGGTACTCGAGTACCATTTCATTATGCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-531s1c1
Sequence:CCGGGCAGCCTTTCACTATTGACAACTCGAGTTGTCAATAGTGAAAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-735s1c1
Sequence:CCGGCCTTCAACTCTACAACTACTTCTCGAGAAGTAGTTGTAGAGTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-762s1c1
Sequence:CCGGCCAGCAGAGGATCTACTTAATCTCGAGATTAAGTAGATCCTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_181344
AURKB MISSION shRNA Lentiviral Transduction Particles
aurora kinase B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-1231s1c1
Sequence:CCGGCTCATCTCCAAGCTGCTCAAACTCGAGTTTGAGCAGCTTGGAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-1066s1c1
Sequence:CCGGCGCATGCATAATGAAATGGTACTCGAGTACCATTTCATTATGCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-531s1c1
Sequence:CCGGGCAGCCTTTCACTATTGACAACTCGAGTTGTCAATAGTGAAAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-735s1c1
Sequence:CCGGCCTTCAACTCTACAACTACTTCTCGAGAAGTAGTTGTAGAGTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181344.3-762s1c1
Sequence:CCGGCCAGCAGAGGATCTACTTAATCTCGAGATTAAGTAGATCCTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011496
VALIDATED
AURKB MISSION shRNA Bacterial Glycerol Stock
aurora kinase B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-697s21c1
Sequence:CCGGCTTCGCCGAGAGATCGAAATCCTCGAGGATTTCGATCTCTCGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-904s21c1
Sequence:CCGGTGCCACAAGAAGAAGGTAATTCTCGAGAATTACCTTCTTCTTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-771s21c1
Sequence:CCGGCCAGCAGAGGATCTACTTAATCTCGAGATTAAGTAGATCCTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-744s21c1
Sequence:CCGGCCTTCAACTCTACAACTACTTCTCGAGAAGTAGTTGTAGAGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-1240s21c1
Sequence:CCGGCTCATCTCCAAGCTGCTCAAACTCGAGTTTGAGCAGCTTGGAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011496
VALIDATED
AURKB MISSION shRNA shRNA Plasmid DNA
aurora kinase B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-697s21c1
Sequence:CCGGCTTCGCCGAGAGATCGAAATCCTCGAGGATTTCGATCTCTCGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-904s21c1
Sequence:CCGGTGCCACAAGAAGAAGGTAATTCTCGAGAATTACCTTCTTCTTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-771s21c1
Sequence:CCGGCCAGCAGAGGATCTACTTAATCTCGAGATTAAGTAGATCCTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-744s21c1
Sequence:CCGGCCTTCAACTCTACAACTACTTCTCGAGAAGTAGTTGTAGAGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-1240s21c1
Sequence:CCGGCTCATCTCCAAGCTGCTCAAACTCGAGTTTGAGCAGCTTGGAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011496
VALIDATED
AURKB MISSION shRNA Lentiviral Transduction Particles
aurora kinase B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-697s21c1
Sequence:CCGGCTTCGCCGAGAGATCGAAATCCTCGAGGATTTCGATCTCTCGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-904s21c1
Sequence:CCGGTGCCACAAGAAGAAGGTAATTCTCGAGAATTACCTTCTTCTTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-771s21c1
Sequence:CCGGCCAGCAGAGGATCTACTTAATCTCGAGATTAAGTAGATCCTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-744s21c1
Sequence:CCGGCCTTCAACTCTACAACTACTTCTCGAGAAGTAGTTGTAGAGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011496.1-1240s21c1
Sequence:CCGGCTCATCTCCAAGCTGCTCAAACTCGAGTTTGAGCAGCTTGGAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks