EMAIL THIS PAGE TO A FRIEND

AURKC

aurora kinase C

119 Gene Product Result for
Synonyms: AIE2 AIK3 ARK3 AurC SPGF5 STK13 aurora-C
UniProtKB ID: Q9UQB9, O60681, O75442, Q6AZY8, Q6DLZ0, Q9UPK5
Gene ID:
Human(6795) Summary: This gene encodes a member of the Aurora subfamily of serine/threonine protein kinases. The encoded protein is a chromosomal passenger protein that forms complexes with Aurora-B and inner centromere proteins and may play a role in organizing microtubules in relation to centrosome/spindle function during mitosis. This gene is overexpressed in several cancer cell lines, suggesting an involvement in oncogenic signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(20871) aurora kinase C
Rat(292554) aurora kinase C
naked mole-rat(101716027) aurora kinase C
sheep(101104774) aurora kinase C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100675 Anti-AURKC (17-30) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1300092 Anti-AURKC (C-term K255) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2501631 Anti-AURKC (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1406495 Anti-AURKC antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103462 Anti-AURKC antibody produced in rabbit affinity isolated antibody rat, human
western blot pricing
HPA034859 Anti-AURKC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1300093 Anti-Aurora-C (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1300369 Anti-Aurora-C (center) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1306021 ANTI-AURORA-C (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB1300368 Anti-Aurora-C (N-term G11) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1306626 ANTI-AURORA-C (N-TERM G11) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300367 Anti-Aurora-C (N-term M1) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1306625 ANTI-AURORA-C (N-TERM M1) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300366 Anti-Aurora-C (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1306624 ANTI-AURORA-C(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1302526 ANTI-MOUSE AURKC (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0024 AQUA Peptide FGNVYLA[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing
AQ0027 AQUA Peptide DIKPENLLLGF[R] human pricing
AQ0028 AQUA Peptide LPLAQIL[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015878 Rosetta Predictions human pricing
NM_001015879 Rosetta Predictions human pricing
NM_003160 Rosetta Predictions human pricing
NM_001106221 Rosetta Predictions rat pricing
NM_001080965 Rosetta Predictions mouse pricing
NM_001080966 Rosetta Predictions mouse pricing
NM_020572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054852 predicted 794
2 SASI_Hs01_00054853 predicted 643
3 SASI_Hs01_00054855 predicted 494
4 SASI_Hs01_00054856 predicted 776
5 SASI_Hs01_00054857 predicted 929
6 SASI_Hs01_00054858 predicted 588
7 SASI_Hs01_00054859 predicted 952
8 SASI_Hs01_00054860 predicted 666
9 SASI_Hs02_00306665 predicted 718
10 SASI_Hs01_00054861 predicted 938
11 SASI_Hs01_00054854 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109165 predicted 651
2 SASI_Hs01_00109166 predicted 501
3 SASI_Hs01_00109168 predicted 360
4 SASI_Hs01_00109169 predicted 631
5 SASI_Hs01_00109170 predicted 784
6 SASI_Hs01_00109171 predicted 451
7 SASI_Hs01_00109172 predicted 805
8 SASI_Hs01_00109173 predicted 527
9 SASI_Hs02_00306666 predicted 575
10 SASI_Hs01_00109174 predicted 802
11 SASI_Hs01_00109167 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029298 predicted 659
2 SASI_Hs01_00029299 predicted 503
3 SASI_Hs01_00029301 predicted 361
4 SASI_Hs01_00029302 predicted 636
5 SASI_Hs01_00029303 predicted 796
6 SASI_Hs01_00029304 predicted 449
7 SASI_Hs01_00029305 predicted 810
8 SASI_Hs01_00029306 predicted 530
9 SASI_Hs02_00335168 predicted 583
10 SASI_Hs01_00029307 predicted 811
11 SASI_Hs01_00029300 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216828 predicted 308
2 SASI_Rn02_00216829 predicted 222
3 SASI_Rn02_00216830 predicted 307
4 SASI_Rn02_00216831 predicted 241
5 SASI_Rn02_00216832 predicted 294
6 SASI_Rn02_00216833 predicted 305
7 SASI_Rn02_00216834 predicted 248
8 SASI_Rn02_00216835 predicted 375
9 SASI_Rn02_00216836 predicted 439
10 SASI_Rn02_00216837 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294153 predicted 402
2 SASI_Mm02_00294154 predicted 398
3 SASI_Mm02_00294155 predicted 508
4 SASI_Mm02_00294156 predicted 393
5 SASI_Mm02_00294157 predicted 831
6 SASI_Mm02_00294158 predicted 508
7 SASI_Mm02_00294159 predicted 433
8 SASI_Mm02_00294160 predicted 366
9 SASI_Mm02_00294161 predicted 418
10 SASI_Mm02_00294162 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294163 predicted 694
2 SASI_Mm02_00294164 predicted 686
3 SASI_Mm02_00294165 predicted 796
4 SASI_Mm02_00294166 predicted 674
5 SASI_Mm02_00294167 predicted 1121
6 SASI_Mm02_00294168 predicted 798
7 SASI_Mm02_00294169 predicted 713
8 SASI_Mm02_00294170 predicted 652
9 SASI_Mm02_00294171 predicted 708
10 SASI_Mm02_00294172 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325631 predicted 568
2 SASI_Mm01_00023080 predicted 563
3 SASI_Mm02_00325632 predicted 673
4 SASI_Mm02_00325633 predicted 551
5 SASI_Mm01_00023076 predicted 996
6 SASI_Mm02_00325634 predicted 672
7 SASI_Mm01_00023073 predicted 591
8 SASI_Mm02_00325635 predicted 525
9 SASI_Mm02_00325636 predicted 579
10 SASI_Mm02_00325637 predicted 557
11 SASI_Mm01_00023072 predicted 686
12 SASI_Mm01_00023074 predicted 1166
13 SASI_Mm01_00023075 predicted 777
14 SASI_Mm01_00023077 predicted 986
15 SASI_Mm01_00023078 predicted 937
16 SASI_Mm01_00023079 predicted 918
17 SASI_Mm01_00023081 predicted 893
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020572
AURKC MISSION shRNA Bacterial Glycerol Stock
aurora kinase C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-588s21c1
Sequence:CCGGCTATGATGACACTCGGATATACTCGAGTATATCCGAGTGTCATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-679s21c1
Sequence:CCGGCAGCGTACAGCCACGATAATACTCGAGTATTATCGTGGCTGTACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-1062s21c1
Sequence:CCGGCTTGATCTCCAAGCTTCTTAGCTCGAGCTAAGAAGCTTGGAGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-890s21c1
Sequence:CCGGTAGCGCAGAAACCGTACAATGCTCGAGCATTGTACGGTTTCTGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-816s1c1
Sequence:CCGGCCATGAGAAGAAGGTGATTCACTCGAGTGAATCACCTTCTTCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-1077s1c1
Sequence:CCGGCAGTGAGACATATAGACGCATCTCGAGATGCGTCTATATGTCTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-967s1c1
Sequence:CCGGCCGGAAATGATAGCGCAGAAACTCGAGTTTCTGCGCTATCATTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-988s1c1
Sequence:CCGGCCGTACAATGAGATGGTTGATCTCGAGATCAACCATCTCATTGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-776s1c1
Sequence:CCGGCCACGATAATTCAGGAGTTGTCTCGAGACAACTCCTGAATTATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020572
AURKC MISSION shRNA shRNA Plasmid DNA
aurora kinase C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-588s21c1
Sequence:CCGGCTATGATGACACTCGGATATACTCGAGTATATCCGAGTGTCATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-679s21c1
Sequence:CCGGCAGCGTACAGCCACGATAATACTCGAGTATTATCGTGGCTGTACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-1062s21c1
Sequence:CCGGCTTGATCTCCAAGCTTCTTAGCTCGAGCTAAGAAGCTTGGAGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-890s21c1
Sequence:CCGGTAGCGCAGAAACCGTACAATGCTCGAGCATTGTACGGTTTCTGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-816s1c1
Sequence:CCGGCCATGAGAAGAAGGTGATTCACTCGAGTGAATCACCTTCTTCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-1077s1c1
Sequence:CCGGCAGTGAGACATATAGACGCATCTCGAGATGCGTCTATATGTCTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-967s1c1
Sequence:CCGGCCGGAAATGATAGCGCAGAAACTCGAGTTTCTGCGCTATCATTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-988s1c1
Sequence:CCGGCCGTACAATGAGATGGTTGATCTCGAGATCAACCATCTCATTGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-776s1c1
Sequence:CCGGCCACGATAATTCAGGAGTTGTCTCGAGACAACTCCTGAATTATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020572
AURKC MISSION shRNA Lentiviral Transduction Particles
aurora kinase C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-588s21c1
Sequence:CCGGCTATGATGACACTCGGATATACTCGAGTATATCCGAGTGTCATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-679s21c1
Sequence:CCGGCAGCGTACAGCCACGATAATACTCGAGTATTATCGTGGCTGTACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-1062s21c1
Sequence:CCGGCTTGATCTCCAAGCTTCTTAGCTCGAGCTAAGAAGCTTGGAGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020572.2-890s21c1
Sequence:CCGGTAGCGCAGAAACCGTACAATGCTCGAGCATTGTACGGTTTCTGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-816s1c1
Sequence:CCGGCCATGAGAAGAAGGTGATTCACTCGAGTGAATCACCTTCTTCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-1077s1c1
Sequence:CCGGCAGTGAGACATATAGACGCATCTCGAGATGCGTCTATATGTCTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-967s1c1
Sequence:CCGGCCGGAAATGATAGCGCAGAAACTCGAGTTTCTGCGCTATCATTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-988s1c1
Sequence:CCGGCCGTACAATGAGATGGTTGATCTCGAGATCAACCATCTCATTGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020572.1-776s1c1
Sequence:CCGGCCACGATAATTCAGGAGTTGTCTCGAGACAACTCCTGAATTATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003160
AURKC MISSION shRNA Bacterial Glycerol Stock
aurora kinase C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-354s1c1
Sequence:CCGGCCCAATATCCTGCGCCTGTATCTCGAGATACAGGCGCAGGATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-371s1c1
Sequence:CCGGGTATAACTATTTCCATGATGCCTCGAGGCATCATGGAAATAGTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-457s1c1
Sequence:CCGGGCGAGAAATTAGATGAACAGCCTCGAGGCTGTTCATCTAATTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-953s1c1
Sequence:CCGGGCTGCCTCCCTGTGCTCAGATCTCGAGATCTGAGCACAGGGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-248s1c1
Sequence:CCGGCCATTTCATTGTGGCCCTGAACTCGAGTTCAGGGCCACAATGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-783s1c1
Sequence:CCGGTGAGGTGAAGATTGCAGATTTCTCGAGAAATCTGCAATCTTCACCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-558s1c1
Sequence:CCGGCCTGCGCCTGTATAACTATTTCTCGAGAAATAGTTATACAGGCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-717s1c1
Sequence:CCGGCTGCCATGACAAGAAAGTGATCTCGAGATCACTTTCTTGTCATGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003160.x-1228s1c1
Sequence:CCGGCTCTGCCACCTCATTTGTCTTCTCGAGAAGACAAATGAGGTGGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-679s1c1
Sequence:CCGGGCCACGATAATAGAGGAAGTTCTCGAGAACTTCCTCTATTATCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003160
AURKC MISSION shRNA shRNA Plasmid DNA
aurora kinase C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-354s1c1
Sequence:CCGGCCCAATATCCTGCGCCTGTATCTCGAGATACAGGCGCAGGATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-371s1c1
Sequence:CCGGGTATAACTATTTCCATGATGCCTCGAGGCATCATGGAAATAGTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-457s1c1
Sequence:CCGGGCGAGAAATTAGATGAACAGCCTCGAGGCTGTTCATCTAATTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-953s1c1
Sequence:CCGGGCTGCCTCCCTGTGCTCAGATCTCGAGATCTGAGCACAGGGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-248s1c1
Sequence:CCGGCCATTTCATTGTGGCCCTGAACTCGAGTTCAGGGCCACAATGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-783s1c1
Sequence:CCGGTGAGGTGAAGATTGCAGATTTCTCGAGAAATCTGCAATCTTCACCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-558s1c1
Sequence:CCGGCCTGCGCCTGTATAACTATTTCTCGAGAAATAGTTATACAGGCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-717s1c1
Sequence:CCGGCTGCCATGACAAGAAAGTGATCTCGAGATCACTTTCTTGTCATGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003160.x-1228s1c1
Sequence:CCGGCTCTGCCACCTCATTTGTCTTCTCGAGAAGACAAATGAGGTGGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-679s1c1
Sequence:CCGGGCCACGATAATAGAGGAAGTTCTCGAGAACTTCCTCTATTATCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003160
AURKC MISSION shRNA Lentiviral Transduction Particles
aurora kinase C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-354s1c1
Sequence:CCGGCCCAATATCCTGCGCCTGTATCTCGAGATACAGGCGCAGGATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-371s1c1
Sequence:CCGGGTATAACTATTTCCATGATGCCTCGAGGCATCATGGAAATAGTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-457s1c1
Sequence:CCGGGCGAGAAATTAGATGAACAGCCTCGAGGCTGTTCATCTAATTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-953s1c1
Sequence:CCGGGCTGCCTCCCTGTGCTCAGATCTCGAGATCTGAGCACAGGGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.2-248s1c1
Sequence:CCGGCCATTTCATTGTGGCCCTGAACTCGAGTTCAGGGCCACAATGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-783s1c1
Sequence:CCGGTGAGGTGAAGATTGCAGATTTCTCGAGAAATCTGCAATCTTCACCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-558s1c1
Sequence:CCGGCCTGCGCCTGTATAACTATTTCTCGAGAAATAGTTATACAGGCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-717s1c1
Sequence:CCGGCTGCCATGACAAGAAAGTGATCTCGAGATCACTTTCTTGTCATGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003160.x-1228s1c1
Sequence:CCGGCTCTGCCACCTCATTTGTCTTCTCGAGAAGACAAATGAGGTGGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003160.x-679s1c1
Sequence:CCGGGCCACGATAATAGAGGAAGTTCTCGAGAACTTCCTCTATTATCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks