EMAIL THIS PAGE TO A FRIEND

AUTS2

autism susceptibility candidate 2

81 Gene Product Result for
Synonyms: FBRSL2
UniProtKB ID: Q8WXX7, A4D1Y9, Q5D049, Q6PJU5, Q9Y4F2
Gene ID:
Mouse(319974) autism susceptibility candidate 2
Rat(498173) autism susceptibility candidate 2
Zebrafish(368890) autism susceptibility candidate 2
Horse(100062562) autism susceptibility candidate 2
domestic cat(101099855) autism susceptibility candidate 2
dog(479709) autism susceptibility candidate 2
chicken(417481) autism susceptibility candidate 2
Domestic Rabbit(100351572) autism susceptibility candidate 2
domestic guinea pig(100735074) autism susceptibility candidate 2
naked mole-rat(101717933) autism susceptibility candidate 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015570 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127231 Rosetta Predictions human pricing
NM_001127232 Rosetta Predictions human pricing
NM_015570 Rosetta Predictions human pricing
XM_573389 Rosetta Predictions rat pricing
NM_177047 Rosetta Predictions mouse pricing
XM_001052037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328957 predicted 1103
2 SASI_Hs02_00328958 predicted 1170
3 SASI_Hs02_00328959 predicted 1150
4 SASI_Hs02_00328960 predicted 1167
5 SASI_Hs02_00328961 predicted 1127
6 SASI_Hs02_00328962 predicted 1173
7 SASI_Hs02_00328963 predicted 1173
8 SASI_Hs02_00328964 predicted 1167
9 SASI_Hs02_00328965 predicted 1111
10 SASI_Hs02_00328966 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328967 predicted 1116
2 SASI_Hs02_00328968 predicted 1181
3 SASI_Hs02_00328969 predicted 1162
4 SASI_Hs02_00328970 predicted 1171
5 SASI_Hs02_00328971 predicted 1140
6 SASI_Hs02_00328972 predicted 1177
7 SASI_Hs02_00328973 predicted 1179
8 SASI_Hs02_00328974 predicted 1171
9 SASI_Hs02_00328975 predicted 1122
10 SASI_Hs02_00328976 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348142 predicted 1111
2 SASI_Hs02_00348143 predicted 1176
3 SASI_Hs02_00348144 predicted 1154
4 SASI_Hs02_00348145 predicted 1179
5 SASI_Hs02_00348146 predicted 1139
6 SASI_Hs02_00348147 predicted 1181
7 SASI_Hs02_00348148 predicted 1181
8 SASI_Hs02_00348149 predicted 1167
9 SASI_Hs02_00348150 predicted 1121
10 SASI_Hs02_00348151 predicted 1102
11 SASI_Hs01_00041437 predicted 2613
12 SASI_Hs01_00041438 predicted 1191
13 SASI_Hs01_00041439 predicted 1042
14 SASI_Hs01_00041440 predicted 1054
15 SASI_Hs01_00041441 predicted 2801
16 SASI_Hs01_00041442 predicted 2937
17 SASI_Hs01_00041443 predicted 1133
18 SASI_Hs01_00041444 predicted 2799
19 SASI_Hs01_00041445 predicted 2915
20 SASI_Hs01_00041446 predicted 4078
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400206 predicted 1380
2 SASI_Rn02_00400207 predicted 1358
3 SASI_Rn02_00400208 predicted 1057
4 SASI_Rn02_00400209 predicted 1357
5 SASI_Rn02_00400210 predicted 998
6 SASI_Rn02_00400211 predicted 1189
7 SASI_Rn02_00400212 predicted 1010
8 SASI_Rn02_00400213 predicted 1256
9 SASI_Rn02_00400214 predicted 1197
10 SASI_Rn02_00400215 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346997 predicted 1235
2 SASI_Mm02_00346998 predicted 2225
3 SASI_Mm02_00346999 predicted 3033
4 SASI_Mm02_00347000 predicted 2475
5 SASI_Mm02_00347001 predicted 2826
6 SASI_Mm02_00347002 predicted 1507
7 SASI_Mm02_00347003 predicted 817
8 SASI_Mm02_00347004 predicted 1299
9 SASI_Mm02_00347005 predicted 2818
10 SASI_Mm02_00347006 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224939 predicted 1827
2 SASI_Mm01_00224940 predicted 884
3 SASI_Mm01_00224941 predicted 1029
4 SASI_Mm01_00224942 predicted 825
5 SASI_Mm01_00224943 predicted 913
6 SASI_Mm01_00224944 predicted 1144
7 SASI_Mm01_00224945 predicted 1117
8 SASI_Mm01_00224946 predicted 1105
9 SASI_Mm01_00224947 predicted 1115
10 SASI_Mm01_00224948 predicted 1837
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015570
AUTS2 MISSION shRNA Bacterial Glycerol Stock
autism susceptibility candidate 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-1498s1c1
Sequence:CCGGGCCTACAACAGCAGTAGCTTACTCGAGTAAGCTACTGCTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015570.1-4694s1c1
Sequence:CCGGCCCTTCAACTATGCAATGAATCTCGAGATTCATTGCATAGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-2621s1c1
Sequence:CCGGCTTCCGTTACACCCAACTCAACTCGAGTTGAGTTGGGTGTAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-3553s1c1
Sequence:CCGGCCTTACCGAGAACTTGACATTCTCGAGAATGTCAAGTTCTCGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-2818s1c1
Sequence:CCGGCGAGACTCATCTGTTAGTAAACTCGAGTTTACTAACAGATGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-1477s21c1
Sequence:CCGGTAAACAAAGATCCGGAGTTAGCTCGAGCTAACTCCGGATCTTTGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-1612s21c1
Sequence:CCGGTTGAGCCTGTGGTGCTTAAAGCTCGAGCTTTAAGCACCACAGGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-2653s21c1
Sequence:CCGGATCCTTTCAGACCTATGTTAACTCGAGTTAACATAGGTCTGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-3043s21c1
Sequence:CCGGCTTCCGTTACACCCAACTCAACTCGAGTTGAGTTGGGTGTAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015570.2-4932s21c1
Sequence:CCGGTCATGAGCTAATGGTTCATATCTCGAGATATGAACCATTAGCTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015570
AUTS2 MISSION shRNA shRNA Plasmid DNA
autism susceptibility candidate 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-1498s1c1
Sequence:CCGGGCCTACAACAGCAGTAGCTTACTCGAGTAAGCTACTGCTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015570.1-4694s1c1
Sequence:CCGGCCCTTCAACTATGCAATGAATCTCGAGATTCATTGCATAGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-2621s1c1
Sequence:CCGGCTTCCGTTACACCCAACTCAACTCGAGTTGAGTTGGGTGTAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-3553s1c1
Sequence:CCGGCCTTACCGAGAACTTGACATTCTCGAGAATGTCAAGTTCTCGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-2818s1c1
Sequence:CCGGCGAGACTCATCTGTTAGTAAACTCGAGTTTACTAACAGATGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-1477s21c1
Sequence:CCGGTAAACAAAGATCCGGAGTTAGCTCGAGCTAACTCCGGATCTTTGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-1612s21c1
Sequence:CCGGTTGAGCCTGTGGTGCTTAAAGCTCGAGCTTTAAGCACCACAGGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-2653s21c1
Sequence:CCGGATCCTTTCAGACCTATGTTAACTCGAGTTAACATAGGTCTGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-3043s21c1
Sequence:CCGGCTTCCGTTACACCCAACTCAACTCGAGTTGAGTTGGGTGTAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015570.2-4932s21c1
Sequence:CCGGTCATGAGCTAATGGTTCATATCTCGAGATATGAACCATTAGCTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015570
AUTS2 MISSION shRNA Lentiviral Transduction Particles
autism susceptibility candidate 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-1498s1c1
Sequence:CCGGGCCTACAACAGCAGTAGCTTACTCGAGTAAGCTACTGCTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015570.1-4694s1c1
Sequence:CCGGCCCTTCAACTATGCAATGAATCTCGAGATTCATTGCATAGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-2621s1c1
Sequence:CCGGCTTCCGTTACACCCAACTCAACTCGAGTTGAGTTGGGTGTAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-3553s1c1
Sequence:CCGGCCTTACCGAGAACTTGACATTCTCGAGAATGTCAAGTTCTCGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015570.1-2818s1c1
Sequence:CCGGCGAGACTCATCTGTTAGTAAACTCGAGTTTACTAACAGATGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-1477s21c1
Sequence:CCGGTAAACAAAGATCCGGAGTTAGCTCGAGCTAACTCCGGATCTTTGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-1612s21c1
Sequence:CCGGTTGAGCCTGTGGTGCTTAAAGCTCGAGCTTTAAGCACCACAGGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-2653s21c1
Sequence:CCGGATCCTTTCAGACCTATGTTAACTCGAGTTAACATAGGTCTGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015570.2-3043s21c1
Sequence:CCGGCTTCCGTTACACCCAACTCAACTCGAGTTGAGTTGGGTGTAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015570.2-4932s21c1
Sequence:CCGGTCATGAGCTAATGGTTCATATCTCGAGATATGAACCATTAGCTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177047
AUTS2 MISSION shRNA Bacterial Glycerol Stock
autism susceptibility candidate 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-765s21c1
Sequence:CCGGCAGCCGAAGAGGACATCATTGCTCGAGCAATGATGTCCTCTTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-3014s21c1
Sequence:CCGGCGAGACTCCTCCGTTAGTAAACTCGAGTTTACTAACGGAGGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-4237s21c1
Sequence:CCGGTACGCCTCTGTCGGCTGAAATCTCGAGATTTCAGCCGACAGAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-2480s21c1
Sequence:CCGGCATATCGCCTGGCAGATTTATCTCGAGATAAATCTGCCAGGCGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177047.3-4715s21c1
Sequence:CCGGTCGTGAGCTGACGGTTCATATCTCGAGATATGAACCGTCAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177047
AUTS2 MISSION shRNA shRNA Plasmid DNA
autism susceptibility candidate 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-765s21c1
Sequence:CCGGCAGCCGAAGAGGACATCATTGCTCGAGCAATGATGTCCTCTTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-3014s21c1
Sequence:CCGGCGAGACTCCTCCGTTAGTAAACTCGAGTTTACTAACGGAGGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-4237s21c1
Sequence:CCGGTACGCCTCTGTCGGCTGAAATCTCGAGATTTCAGCCGACAGAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-2480s21c1
Sequence:CCGGCATATCGCCTGGCAGATTTATCTCGAGATAAATCTGCCAGGCGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177047.3-4715s21c1
Sequence:CCGGTCGTGAGCTGACGGTTCATATCTCGAGATATGAACCGTCAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177047
AUTS2 MISSION shRNA Lentiviral Transduction Particles
autism susceptibility candidate 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-765s21c1
Sequence:CCGGCAGCCGAAGAGGACATCATTGCTCGAGCAATGATGTCCTCTTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-3014s21c1
Sequence:CCGGCGAGACTCCTCCGTTAGTAAACTCGAGTTTACTAACGGAGGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-4237s21c1
Sequence:CCGGTACGCCTCTGTCGGCTGAAATCTCGAGATTTCAGCCGACAGAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177047.3-2480s21c1
Sequence:CCGGCATATCGCCTGGCAGATTTATCTCGAGATAAATCTGCCAGGCGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177047.3-4715s21c1
Sequence:CCGGTCGTGAGCTGACGGTTCATATCTCGAGATATGAACCGTCAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks