EMAIL THIS PAGE TO A FRIEND

AVEN

apoptosis, caspase activation inhibitor

48 Gene Product Result for
Synonyms: PDCD12
UniProtKB ID: Q9NQS1
Gene ID:
Mouse(74268) apoptosis, caspase activation inhibitor
Rat(311299) apoptosis, caspase activation inhibitor
Zebrafish(692323) apoptosis, caspase activation inhibitor
fruit fly(32215) Aven ortholog
domestic cat(101090442) apoptosis, caspase activation inhibitor
cow(512666) apoptosis, caspase activation inhibitor
chicken(395127) apoptosis, caspase activation inhibitor
dog(478243) apoptosis, caspase activation inhibitor
naked mole-rat(101707174) apoptosis, caspase activation inhibitor
domestic guinea pig(100724317) apoptosis, caspase activation inhibitor
sheep(101111025) apoptosis, caspase activation inhibitor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020371 Rosetta Predictions human pricing
NM_001107757 Rosetta Predictions rat pricing
NM_028844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191697 predicted 725
2 SASI_Hs01_00191698 predicted 910
3 SASI_Hs01_00191699 predicted 1244
4 SASI_Hs01_00191701 predicted 902
5 SASI_Hs01_00191702 predicted 1195
6 SASI_Hs02_00353325 predicted 718
7 SASI_Hs01_00191703 predicted 635
8 SASI_Hs01_00191704 predicted 430
9 SASI_Hs02_00353326 predicted 1225
10 SASI_Hs02_00353327 predicted 918
11 SASI_Hs01_00191696 predicted 537
12 SASI_Hs01_00191700 predicted 709
13 SASI_Hs01_00191705 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231965 predicted 590
2 SASI_Rn02_00231966 predicted 224
3 SASI_Rn02_00231967 predicted 422
4 SASI_Rn02_00231968 predicted 267
5 SASI_Rn02_00231969 predicted 522
6 SASI_Rn02_00231970 predicted 486
7 SASI_Rn02_00231971 predicted 789
8 SASI_Rn02_00231972 predicted 573
9 SASI_Rn02_00231973 predicted 238
10 SASI_Rn02_00231974 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028970 predicted 367
2 SASI_Mm01_00028971 predicted 1000
3 SASI_Mm01_00028972 predicted 336
4 SASI_Mm01_00028973 predicted 576
5 SASI_Mm01_00028974 predicted 746
6 SASI_Mm01_00028975 predicted 556
7 SASI_Mm01_00028976 predicted 525
8 SASI_Mm01_00028977 predicted 857
9 SASI_Mm01_00028978 predicted 746
10 SASI_Mm02_00334491 predicted 875
11 SASI_Mm01_00028979 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020371
VALIDATED
AVEN MISSION shRNA Bacterial Glycerol Stock
apoptosis, caspase activation inhibitor
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-1007s1c1
Sequence:CCGGGTGGTCCAAGAGGAAGAAGTTCTCGAGAACTTCTTCCTCTTGGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-335s1c1
Sequence:CCGGGATGCAGAGACCTATGGAGAACTCGAGTTCTCCATAGGTCTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020371.1-980s1c1
Sequence:CCGGGACCTGAAATCCAAGGAAGATCTCGAGATCTTCCTTGGATTTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-705s1c1
Sequence:CCGGGAACTGATGATGGCAAGGGATCTCGAGATCCCTTGCCATCATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-1070s1c1
Sequence:CCGGGAGCAACCAAGTACCTCCAAACTCGAGTTTGGAGGTACTTGGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-944s1c1
Sequence:CCGGGAGGGAGATAACATCTTACCACTCGAGTGGTAAGATGTTATCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-1013s1c1
Sequence:CCGGCAAGAGGAAGAAGTTTGTGCACTCGAGTGCACAAACTTCTTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020371.1-1120s1c1
Sequence:CCGGGTTGGACAGCATGATTTCCTACTCGAGTAGGAAATCATGCTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-902s1c1
Sequence:CCGGGAAGAACTAGATCTGTTGCTTCTCGAGAAGCAACAGATCTAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-530s1c1
Sequence:CCGGGAGAAAGAATGGGATAGTGAACTCGAGTTCACTATCCCATTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-356s1c1
Sequence:CCGGGAGAATGATGAACAGGGAAATCTCGAGATTTCCCTGTTCATCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020371
VALIDATED
AVEN MISSION shRNA shRNA Plasmid DNA
apoptosis, caspase activation inhibitor
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-1007s1c1
Sequence:CCGGGTGGTCCAAGAGGAAGAAGTTCTCGAGAACTTCTTCCTCTTGGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-335s1c1
Sequence:CCGGGATGCAGAGACCTATGGAGAACTCGAGTTCTCCATAGGTCTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020371.1-980s1c1
Sequence:CCGGGACCTGAAATCCAAGGAAGATCTCGAGATCTTCCTTGGATTTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-705s1c1
Sequence:CCGGGAACTGATGATGGCAAGGGATCTCGAGATCCCTTGCCATCATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-1070s1c1
Sequence:CCGGGAGCAACCAAGTACCTCCAAACTCGAGTTTGGAGGTACTTGGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-944s1c1
Sequence:CCGGGAGGGAGATAACATCTTACCACTCGAGTGGTAAGATGTTATCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-1013s1c1
Sequence:CCGGCAAGAGGAAGAAGTTTGTGCACTCGAGTGCACAAACTTCTTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020371.1-1120s1c1
Sequence:CCGGGTTGGACAGCATGATTTCCTACTCGAGTAGGAAATCATGCTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-902s1c1
Sequence:CCGGGAAGAACTAGATCTGTTGCTTCTCGAGAAGCAACAGATCTAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-530s1c1
Sequence:CCGGGAGAAAGAATGGGATAGTGAACTCGAGTTCACTATCCCATTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-356s1c1
Sequence:CCGGGAGAATGATGAACAGGGAAATCTCGAGATTTCCCTGTTCATCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020371
VALIDATED
AVEN MISSION shRNA Lentiviral Transduction Particles
apoptosis, caspase activation inhibitor
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-1007s1c1
Sequence:CCGGGTGGTCCAAGAGGAAGAAGTTCTCGAGAACTTCTTCCTCTTGGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-335s1c1
Sequence:CCGGGATGCAGAGACCTATGGAGAACTCGAGTTCTCCATAGGTCTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020371.1-980s1c1
Sequence:CCGGGACCTGAAATCCAAGGAAGATCTCGAGATCTTCCTTGGATTTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-705s1c1
Sequence:CCGGGAACTGATGATGGCAAGGGATCTCGAGATCCCTTGCCATCATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-1070s1c1
Sequence:CCGGGAGCAACCAAGTACCTCCAAACTCGAGTTTGGAGGTACTTGGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-944s1c1
Sequence:CCGGGAGGGAGATAACATCTTACCACTCGAGTGGTAAGATGTTATCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-1013s1c1
Sequence:CCGGCAAGAGGAAGAAGTTTGTGCACTCGAGTGCACAAACTTCTTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020371.1-1120s1c1
Sequence:CCGGGTTGGACAGCATGATTTCCTACTCGAGTAGGAAATCATGCTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020371.1-902s1c1
Sequence:CCGGGAAGAACTAGATCTGTTGCTTCTCGAGAAGCAACAGATCTAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-530s1c1
Sequence:CCGGGAGAAAGAATGGGATAGTGAACTCGAGTTCACTATCCCATTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020371.1-356s1c1
Sequence:CCGGGAGAATGATGAACAGGGAAATCTCGAGATTTCCCTGTTCATCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028844
VALIDATED
AVEN MISSION shRNA Bacterial Glycerol Stock
apoptosis, caspase activation inhibitor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-1084s1c1
Sequence:CCGGGAAGCAAATGCTGGTTGCCTTCTCGAGAAGGCAACCAGCATTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-821s1c1
Sequence:CCGGGAACTAGATATGTTGCTGCATCTCGAGATGCAGCAACATATCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-591s1c1
Sequence:CCGGCAGAATTGATCCAGACCACAACTCGAGTTGTGGTCTGGATCAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-593s1c1
Sequence:CCGGGAATTGATCCAGACCACAATTCTCGAGAATTGTGGTCTGGATCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-823s1c1
Sequence:CCGGACTAGATATGTTGCTGCATTTCTCGAGAAATGCAGCAACATATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028844
VALIDATED
AVEN MISSION shRNA shRNA Plasmid DNA
apoptosis, caspase activation inhibitor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-1084s1c1
Sequence:CCGGGAAGCAAATGCTGGTTGCCTTCTCGAGAAGGCAACCAGCATTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-821s1c1
Sequence:CCGGGAACTAGATATGTTGCTGCATCTCGAGATGCAGCAACATATCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-591s1c1
Sequence:CCGGCAGAATTGATCCAGACCACAACTCGAGTTGTGGTCTGGATCAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-593s1c1
Sequence:CCGGGAATTGATCCAGACCACAATTCTCGAGAATTGTGGTCTGGATCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-823s1c1
Sequence:CCGGACTAGATATGTTGCTGCATTTCTCGAGAAATGCAGCAACATATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028844
VALIDATED
AVEN MISSION shRNA Lentiviral Transduction Particles
apoptosis, caspase activation inhibitor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-1084s1c1
Sequence:CCGGGAAGCAAATGCTGGTTGCCTTCTCGAGAAGGCAACCAGCATTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-821s1c1
Sequence:CCGGGAACTAGATATGTTGCTGCATCTCGAGATGCAGCAACATATCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-591s1c1
Sequence:CCGGCAGAATTGATCCAGACCACAACTCGAGTTGTGGTCTGGATCAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-593s1c1
Sequence:CCGGGAATTGATCCAGACCACAATTCTCGAGAATTGTGGTCTGGATCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028844.1-823s1c1
Sequence:CCGGACTAGATATGTTGCTGCATTTCTCGAGAAATGCAGCAACATATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks