EMAIL THIS PAGE TO A FRIEND

AVIL

advillin

46 Gene Product Result for
Synonyms: ADVIL DOC6 p92
UniProtKB ID: O75366, B2RAU7, Q2NKM9
Gene ID:
Human(10677) Summary: The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
Mouse(11567) advillin
Rat(79253) advillin
sheep(101114855) advillin
cow(520771) advillin
Horse(100051151) advillin
dog(474420) advillin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100191 Anti-AVIL (ab1) antibody produced in rabbit affinity isolated antibody mouse, guinea pig, human, rabbit, horse, rat, canine
western blot pricing
SAB2100192 Anti-AVIL (ab2) antibody produced in rabbit affinity isolated antibody mouse, horse, rabbit, human, guinea pig, rat, canine
western blot pricing
HPA058864 Anti-AVIL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106231 Anti-AVIL antibody produced in rabbit affinity isolated antibody human, horse, rabbit, rat, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006576 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006576 Rosetta Predictions human pricing
NM_024401 Rosetta Predictions rat pricing
NM_009635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020571 predicted 1897
2 SASI_Hs01_00020572 predicted 2235
3 SASI_Hs01_00020573 predicted 2094
4 SASI_Hs01_00020574 predicted 2271
5 SASI_Hs01_00020575 predicted 1129
6 SASI_Hs01_00020576 predicted 2279
7 SASI_Hs01_00020577 predicted 774
8 SASI_Hs02_00341866 predicted 1869
9 SASI_Hs01_00020578 predicted 1954
10 SASI_Hs01_00020579 predicted 1887
11 SASI_Hs01_00020580 predicted 1638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073748 predicted 946
2 SASI_Rn01_00073749 predicted 979
3 SASI_Rn01_00073750 predicted 1396
4 SASI_Rn01_00073751 predicted 1727
5 SASI_Rn01_00073752 predicted 1425
6 SASI_Rn02_00264001 predicted 2043
7 SASI_Rn01_00073753 predicted 1670
8 SASI_Rn01_00073754 predicted 995
9 SASI_Rn01_00073755 predicted 1645
10 SASI_Rn01_00073756 predicted 1074
11 SASI_Rn01_00073747 predicted 2264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181287 predicted 880
2 SASI_Mm01_00181288 predicted 2272
3 SASI_Mm01_00181289 predicted 2065
4 SASI_Mm01_00181290 predicted 2297
5 SASI_Mm01_00181291 predicted 870
6 SASI_Mm01_00181292 predicted 2210
7 SASI_Mm01_00181293 predicted 606
8 SASI_Mm01_00181294 predicted 585
9 SASI_Mm01_00181295 predicted 2390
10 SASI_Mm01_00181296 predicted 2410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006576
AVIL MISSION shRNA Bacterial Glycerol Stock
advillin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-764s1c1
Sequence:CCGGGCAGAAATCAACTATCATGTTCTCGAGAACATGATAGTTGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-1307s1c1
Sequence:CCGGCCTCTACACATACGAGGTAAACTCGAGTTTACCTCGTATGTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-632s1c1
Sequence:CCGGCCGTGCTGAAATAGGAGTGATCTCGAGATCACTCCTATTTCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-1878s1c1
Sequence:CCGGCGTCTCTTTGAATGTTCCAATCTCGAGATTGGAACATTCAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-1254s1c1
Sequence:CCGGCCTGTGGAGTATCAATGGTATCTCGAGATACCATTGATACTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006576.2-2538s21c1
Sequence:CCGGTGCCAATATCAGGAAATAATTCTCGAGAATTATTTCCTGATATTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006576.2-2528s21c1
Sequence:CCGGGAGCAGATAGTGCCAATATCACTCGAGTGATATTGGCACTATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006576.2-1493s21c1
Sequence:CCGGCTTCAAAGGGAAGCTAGTTATCTCGAGATAACTAGCTTCCCTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006576
AVIL MISSION shRNA shRNA Plasmid DNA
advillin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-764s1c1
Sequence:CCGGGCAGAAATCAACTATCATGTTCTCGAGAACATGATAGTTGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-1307s1c1
Sequence:CCGGCCTCTACACATACGAGGTAAACTCGAGTTTACCTCGTATGTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-632s1c1
Sequence:CCGGCCGTGCTGAAATAGGAGTGATCTCGAGATCACTCCTATTTCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-1878s1c1
Sequence:CCGGCGTCTCTTTGAATGTTCCAATCTCGAGATTGGAACATTCAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-1254s1c1
Sequence:CCGGCCTGTGGAGTATCAATGGTATCTCGAGATACCATTGATACTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006576.2-2538s21c1
Sequence:CCGGTGCCAATATCAGGAAATAATTCTCGAGAATTATTTCCTGATATTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006576.2-2528s21c1
Sequence:CCGGGAGCAGATAGTGCCAATATCACTCGAGTGATATTGGCACTATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006576.2-1493s21c1
Sequence:CCGGCTTCAAAGGGAAGCTAGTTATCTCGAGATAACTAGCTTCCCTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006576
AVIL MISSION shRNA Lentiviral Transduction Particles
advillin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-764s1c1
Sequence:CCGGGCAGAAATCAACTATCATGTTCTCGAGAACATGATAGTTGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-1307s1c1
Sequence:CCGGCCTCTACACATACGAGGTAAACTCGAGTTTACCTCGTATGTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-632s1c1
Sequence:CCGGCCGTGCTGAAATAGGAGTGATCTCGAGATCACTCCTATTTCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-1878s1c1
Sequence:CCGGCGTCTCTTTGAATGTTCCAATCTCGAGATTGGAACATTCAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006576.2-1254s1c1
Sequence:CCGGCCTGTGGAGTATCAATGGTATCTCGAGATACCATTGATACTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006576.2-2538s21c1
Sequence:CCGGTGCCAATATCAGGAAATAATTCTCGAGAATTATTTCCTGATATTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006576.2-2528s21c1
Sequence:CCGGGAGCAGATAGTGCCAATATCACTCGAGTGATATTGGCACTATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006576.2-1493s21c1
Sequence:CCGGCTTCAAAGGGAAGCTAGTTATCTCGAGATAACTAGCTTCCCTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009635
AVIL MISSION shRNA Bacterial Glycerol Stock
advillin
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000090778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009635.2-2863s1c1
Sequence:CCGGGCTTCCAAATACACCCTGCAACTCGAGTTGCAGGGTGTATTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009635.2-804s1c1
Sequence:CCGGCCATGATAAAGCCTGCAGTTTCTCGAGAAACTGCAGGCTTTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009635.2-2466s1c1
Sequence:CCGGTCTCGGAACAAGACTTTGTATCTCGAGATACAAAGTCTTGTTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009635.2-154s1c1
Sequence:CCGGCGGGATCATCACATGGAGAATCTCGAGATTCTCCATGTGATGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009635
AVIL MISSION shRNA shRNA Plasmid DNA
advillin
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000090778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009635.2-2863s1c1
Sequence:CCGGGCTTCCAAATACACCCTGCAACTCGAGTTGCAGGGTGTATTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009635.2-804s1c1
Sequence:CCGGCCATGATAAAGCCTGCAGTTTCTCGAGAAACTGCAGGCTTTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009635.2-2466s1c1
Sequence:CCGGTCTCGGAACAAGACTTTGTATCTCGAGATACAAAGTCTTGTTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009635.2-154s1c1
Sequence:CCGGCGGGATCATCACATGGAGAATCTCGAGATTCTCCATGTGATGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009635
AVIL MISSION shRNA Lentiviral Transduction Particles
advillin
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000090778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009635.2-2863s1c1
Sequence:CCGGGCTTCCAAATACACCCTGCAACTCGAGTTGCAGGGTGTATTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009635.2-804s1c1
Sequence:CCGGCCATGATAAAGCCTGCAGTTTCTCGAGAAACTGCAGGCTTTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009635.2-2466s1c1
Sequence:CCGGTCTCGGAACAAGACTTTGTATCTCGAGATACAAAGTCTTGTTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009635.2-154s1c1
Sequence:CCGGCGGGATCATCACATGGAGAATCTCGAGATTCTCCATGTGATGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks