EMAIL THIS PAGE TO A FRIEND

AVL9

AVL9 homolog (S. cerevisiase)

Synonyms: KIAA0241
UniProtKB ID: Q8NBF6, Q92573
Gene ID:
Mouse(78937) AVL9 homolog (S. cerevisiase)
Rat(312371) AVL9 homolog (S. cerevisiase)
Zebrafish(751682) AVL9 homolog (S. cerevisiase)
cow(534141) AVL9 homolog (S. cerevisiase)
Horse(100070105) AVL9 homolog (S. cerevisiase)
domestic cat(101090505) AVL9 homolog (S. cerevisiase)
dog(482390) AVL9 homolog (S. cerevisiase)
chicken(420750) AVL9 homolog (S. cerevisiase)
sheep(101121004) AVL9 homolog (S. cerevisiase)
naked mole-rat(101719974) AVL9 homolog (S. cerevisiase)
domestic guinea pig(100721985) AVL9 homolog (S. cerevisiase)
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_379801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379801 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015060 Rosetta Predictions human pricing
XM_231797 Rosetta Predictions rat pricing
XR_007937 Rosetta Predictions rat pricing
XM_132538 Rosetta Predictions mouse pricing
XM_907872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136902 predicted 1194
2 SASI_Hs01_00136903 predicted 548
3 SASI_Hs01_00136904 predicted 1571
4 SASI_Hs02_00346915 predicted 1764
5 SASI_Hs01_00136905 predicted 1865
6 SASI_Hs01_00136907 predicted 1857
7 SASI_Hs01_00136908 predicted 600
8 SASI_Hs01_00136909 predicted 1553
9 SASI_Hs01_00136910 predicted 1257
10 SASI_Hs01_00136911 predicted 1314
11 SASI_Hs01_00136906 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134986 predicted 1133
2 SASI_Rn01_00134987 predicted 980
3 SASI_Rn01_00134988 predicted 479
4 SASI_Rn01_00134989 predicted 443
5 SASI_Rn01_00134990 predicted 770
6 SASI_Rn01_00134991 predicted 750
7 SASI_Rn01_00134992 predicted 1175
8 SASI_Rn01_00134993 predicted 594
9 SASI_Rn01_00134994 predicted 952
10 SASI_Rn01_00134995 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00415869 predicted 2412
2 SASI_Rn02_00415870 predicted 2256
3 SASI_Rn02_00415871 predicted 2240
4 SASI_Rn02_00415872 predicted 2251
5 SASI_Rn02_00415873 predicted 2339
6 SASI_Rn02_00415874 predicted 2471
7 SASI_Rn02_00415875 predicted 2230
8 SASI_Rn02_00415876 predicted 2363
9 SASI_Rn02_00415877 predicted 2369
10 SASI_Rn02_00415878 predicted 2407
11 SASI_Rn01_00163613 predicted 224
12 SASI_Rn01_00163614 predicted 263
13 SASI_Rn01_00163615 predicted 249
14 SASI_Rn01_00163616 predicted 225
15 SASI_Rn01_00163617 predicted 221
16 SASI_Rn01_00163618 predicted 280
17 SASI_Rn01_00163619 predicted 228
18 SASI_Rn01_00163620 predicted 249
19 SASI_Rn01_00163621 predicted 273
20 SASI_Rn01_00163622 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280516 predicted 1129
2 SASI_Mm01_00280517 predicted 1346
3 SASI_Mm01_00280518 predicted 599
4 SASI_Mm01_00280520 predicted 984
5 SASI_Mm01_00280521 predicted 1786
6 SASI_Mm01_00280522 predicted 438
7 SASI_Mm01_00280523 predicted 769
8 SASI_Mm01_00280524 predicted 1554
9 SASI_Mm01_00280525 predicted 1135
10 SASI_Mm02_00424473 predicted 768
11 SASI_Mm01_00280519 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433595 predicted 1122
2 SASI_Mm02_00433596 predicted 1341
3 SASI_Mm02_00433597 predicted 599
4 SASI_Mm02_00433598 predicted 985
5 SASI_Mm02_00433599 predicted 1786
6 SASI_Mm02_00433600 predicted 441
7 SASI_Mm02_00433601 predicted 774
8 SASI_Mm02_00433602 predicted 1555
9 SASI_Mm02_00433603 predicted 1137
10 SASI_Mm02_00433604 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030235
VALIDATED
AVL9 MISSION shRNA Bacterial Glycerol Stock
AVL9 homolog (S. cerevisiase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-487s21c1
Sequence:CCGGTATCTCTTGTTATCGACAAATCTCGAGATTTGTCGATAACAAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-2402s21c1
Sequence:CCGGACTTCATTCTGAGCCTAATTACTCGAGTAATTAGGCTCAGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-1008s21c1
Sequence:CCGGAGTCTACTTCTGACGTCTTAACTCGAGTTAAGACGTCAGAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-1883s21c1
Sequence:CCGGCCGGCACTTTCAGAGATAAATCTCGAGATTTATCTCTGAAAGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-1147s21c1
Sequence:CCGGCAGTGATTCTGGCCGATATTTCTCGAGAAATATCGGCCAGAATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030235
VALIDATED
AVL9 MISSION shRNA shRNA Plasmid DNA
AVL9 homolog (S. cerevisiase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-487s21c1
Sequence:CCGGTATCTCTTGTTATCGACAAATCTCGAGATTTGTCGATAACAAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-2402s21c1
Sequence:CCGGACTTCATTCTGAGCCTAATTACTCGAGTAATTAGGCTCAGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-1008s21c1
Sequence:CCGGAGTCTACTTCTGACGTCTTAACTCGAGTTAAGACGTCAGAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-1883s21c1
Sequence:CCGGCCGGCACTTTCAGAGATAAATCTCGAGATTTATCTCTGAAAGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-1147s21c1
Sequence:CCGGCAGTGATTCTGGCCGATATTTCTCGAGAAATATCGGCCAGAATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030235
VALIDATED
AVL9 MISSION shRNA Lentiviral Transduction Particles
AVL9 homolog (S. cerevisiase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-487s21c1
Sequence:CCGGTATCTCTTGTTATCGACAAATCTCGAGATTTGTCGATAACAAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-2402s21c1
Sequence:CCGGACTTCATTCTGAGCCTAATTACTCGAGTAATTAGGCTCAGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-1008s21c1
Sequence:CCGGAGTCTACTTCTGACGTCTTAACTCGAGTTAAGACGTCAGAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-1883s21c1
Sequence:CCGGCCGGCACTTTCAGAGATAAATCTCGAGATTTATCTCTGAAAGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030235.1-1147s21c1
Sequence:CCGGCAGTGATTCTGGCCGATATTTCTCGAGAAATATCGGCCAGAATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379801
VALIDATED
AVL9 MISSION shRNA Bacterial Glycerol Stock
AVL9 homolog (S. cerevisiase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379801.1-418s1c1
Sequence:CCGGGCACACAACTACCAGGAAGATCTCGAGATCTTCCTGGTAGTTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_379801.1-1313s1c1
Sequence:CCGGCCTCAGAGAGTCTTCCAATTACTCGAGTAATTGGAAGACTCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379801.1-3433s1c1
Sequence:CCGGCCTAACTGAAAGTCCTCCTATCTCGAGATAGGAGGACTTTCAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:XM_379801.1-595s1c1
Sequence:CCGGCCTCTGTATGGTTTACTTCAACTCGAGTTGAAGTAAACCATACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379801.1-479s1c1
Sequence:CCGGCCACAGTATTTGGTATCTCTTCTCGAGAAGAGATACCAAATACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379801.1-5312s1c1
Sequence:CCGGGCAATATACTTTGGCAGCAAACTCGAGTTTGCTGCCAAAGTATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_379801.1-2857s1c1
Sequence:CCGGGCAGAGAAATAGCAGAGTGATCTCGAGATCACTCTGCTATTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379801.1-784s1c1
Sequence:CCGGCGACACAAGGTCTTAATCCTACTCGAGTAGGATTAAGACCTTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_379801.1-1777s1c1
Sequence:CCGGGCCACACTGCAATTAGACAATCTCGAGATTGTCTAATTGCAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379801
VALIDATED
AVL9 MISSION shRNA shRNA Plasmid DNA
AVL9 homolog (S. cerevisiase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379801.1-418s1c1
Sequence:CCGGGCACACAACTACCAGGAAGATCTCGAGATCTTCCTGGTAGTTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_379801.1-1313s1c1
Sequence:CCGGCCTCAGAGAGTCTTCCAATTACTCGAGTAATTGGAAGACTCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379801.1-3433s1c1
Sequence:CCGGCCTAACTGAAAGTCCTCCTATCTCGAGATAGGAGGACTTTCAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:XM_379801.1-595s1c1
Sequence:CCGGCCTCTGTATGGTTTACTTCAACTCGAGTTGAAGTAAACCATACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379801.1-479s1c1
Sequence:CCGGCCACAGTATTTGGTATCTCTTCTCGAGAAGAGATACCAAATACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379801.1-5312s1c1
Sequence:CCGGGCAATATACTTTGGCAGCAAACTCGAGTTTGCTGCCAAAGTATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_379801.1-2857s1c1
Sequence:CCGGGCAGAGAAATAGCAGAGTGATCTCGAGATCACTCTGCTATTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379801.1-784s1c1
Sequence:CCGGCGACACAAGGTCTTAATCCTACTCGAGTAGGATTAAGACCTTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_379801.1-1777s1c1
Sequence:CCGGGCCACACTGCAATTAGACAATCTCGAGATTGTCTAATTGCAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379801
VALIDATED
AVL9 MISSION shRNA Lentiviral Transduction Particles
AVL9 homolog (S. cerevisiase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379801.1-418s1c1
Sequence:CCGGGCACACAACTACCAGGAAGATCTCGAGATCTTCCTGGTAGTTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_379801.1-1313s1c1
Sequence:CCGGCCTCAGAGAGTCTTCCAATTACTCGAGTAATTGGAAGACTCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379801.1-3433s1c1
Sequence:CCGGCCTAACTGAAAGTCCTCCTATCTCGAGATAGGAGGACTTTCAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:XM_379801.1-595s1c1
Sequence:CCGGCCTCTGTATGGTTTACTTCAACTCGAGTTGAAGTAAACCATACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379801.1-479s1c1
Sequence:CCGGCCACAGTATTTGGTATCTCTTCTCGAGAAGAGATACCAAATACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379801.1-5312s1c1
Sequence:CCGGGCAATATACTTTGGCAGCAAACTCGAGTTTGCTGCCAAAGTATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_379801.1-2857s1c1
Sequence:CCGGGCAGAGAAATAGCAGAGTGATCTCGAGATCACTCTGCTATTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379801.1-784s1c1
Sequence:CCGGCGACACAAGGTCTTAATCCTACTCGAGTAGGATTAAGACCTTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_379801.1-1777s1c1
Sequence:CCGGGCCACACTGCAATTAGACAATCTCGAGATTGTCTAATTGCAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks