EMAIL THIS PAGE TO A FRIEND

AVP

arginine vasopressin

52 Gene Product Result for
Synonyms: ADH ARVP AVP-NPII AVRP VP
UniProtKB ID: P01185, A0AV35, O14935
Gene ID:
Human(551) Summary: This gene encodes a precursor protein consisting of arginine vasopressin and two associated proteins, neurophysin 2 and a glycopeptide, copeptin. Arginine vasopressin is a posterior pituitary hormone which is synthesized in the supraoptic nucleus and paraventricular nucleus of the hypothalamus. Along with its carrier protein, neurophysin 2, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis where it is either stored or secreted into the bloodstream. The precursor is thought to be activated while it is being transported along the axon to the posterior pituitary. Arginine vasopressin acts as a growth factor by enhancing pH regulation through acid-base transport systems. It has a direct antidiuretic action on the kidney, and also causes vasoconstriction of the peripheral vessels. This hormone can contract smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. Mutations in this gene cause autosomal dominant neurohypophyseal diabetes insipidus (ADNDI). [provided by RefSeq, Mar 2010]
Mouse(11998) arginine vasopressin
Rat(24221) arginine vasopressin
domestic guinea pig(100716009) arginine vasopressin
sheep(443477) arginine vasopressin
Zebrafish(352922) arginine vasopressin
cow(280728) arginine vasopressin
domestic cat(101096305) arginine vasopressin
dog(403579) arginine vasopressin
chicken(396101) arginine vasopressin (neurophysin II, antidiuretic hormone, diabetes insipidus, neurohypophyseal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301597 ANTI-AVP (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4200663 Anti-Copeptin antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000490 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000490 Rosetta Predictions human pricing
NM_016992 Rosetta Predictions rat pricing
NM_009732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148465 predicted 347
2 SASI_Hs01_00148466 predicted 341
3 SASI_Hs01_00148467 predicted 201
4 SASI_Hs01_00148468 predicted 347
5 SASI_Hs01_00148469 predicted 347
6 SASI_Hs01_00148470 predicted 194
7 SASI_Hs01_00148471 predicted 335
8 SASI_Hs01_00148472 predicted 101
9 SASI_Hs01_00148473 predicted 149
10 SASI_Hs01_00148474 predicted 127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101865 predicted 329
2 SASI_Rn01_00101866 predicted 314
3 SASI_Rn01_00101867 predicted 325
4 SASI_Rn01_00101868 predicted 318
5 SASI_Rn01_00101869 predicted 332
6 SASI_Rn01_00101870 predicted 324
7 SASI_Rn01_00101871 predicted 38
8 SASI_Rn01_00101872 predicted 476
9 SASI_Rn02_00261132 predicted 44
10 SASI_Rn01_00101873 predicted 470
11 SASI_Rn01_00101874 predicted 139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051156 predicted 102
2 SASI_Mm01_00051157 predicted 341
3 SASI_Mm01_00051158 predicted 28
4 SASI_Mm01_00051159 predicted 23
5 SASI_Mm01_00051160 predicted 52
6 SASI_Mm01_00051161 predicted 89
7 SASI_Mm01_00051162 predicted 59
8 SASI_Mm01_00051163 predicted 92
9 SASI_Mm01_00051164 predicted 107
10 SASI_Mm01_00051165 predicted 106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000490
AVP MISSION shRNA Bacterial Glycerol Stock
arginine vasopressin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-903s1c1
Sequence:CCGGCAGCATCTGCTGCGCGGACGACTCGAGTCGTCCGCGCAGCAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-822s1c1
Sequence:CCGGCGGCAAGAGGGCCATGTCCGACTCGAGTCGGACATGGCCCTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-765s1c1
Sequence:CCGGCTTCCTCGGCCTACTGGCCTTCTCGAGAAGGCCAGTAGGCCGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-1035s1c1
Sequence:CCGGCGCCTTCGGCGTTTGCTGCAACTCGAGTTGCAGCAAACGCCGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-273s21c1
Sequence:CCGGTGCCAGGAGGAGAACTACCTGCTCGAGCAGGTAGTTCTCCTCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-147s21c1
Sequence:CCGGATGTCCGACCTGGAGCTGAGACTCGAGTCTCAGCTCCAGGTCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-110s21c1
Sequence:CCGGCTACTTCCAGAACTGCCCGAGCTCGAGCTCGGGCAGTTCTGGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-95s21c1
Sequence:CCGGCTTCTCCTCCGCGTGCTACTTCTCGAGAAGTAGCACGCGGAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000490
AVP MISSION shRNA shRNA Plasmid DNA
arginine vasopressin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-903s1c1
Sequence:CCGGCAGCATCTGCTGCGCGGACGACTCGAGTCGTCCGCGCAGCAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-822s1c1
Sequence:CCGGCGGCAAGAGGGCCATGTCCGACTCGAGTCGGACATGGCCCTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-765s1c1
Sequence:CCGGCTTCCTCGGCCTACTGGCCTTCTCGAGAAGGCCAGTAGGCCGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-1035s1c1
Sequence:CCGGCGCCTTCGGCGTTTGCTGCAACTCGAGTTGCAGCAAACGCCGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-273s21c1
Sequence:CCGGTGCCAGGAGGAGAACTACCTGCTCGAGCAGGTAGTTCTCCTCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-147s21c1
Sequence:CCGGATGTCCGACCTGGAGCTGAGACTCGAGTCTCAGCTCCAGGTCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-110s21c1
Sequence:CCGGCTACTTCCAGAACTGCCCGAGCTCGAGCTCGGGCAGTTCTGGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-95s21c1
Sequence:CCGGCTTCTCCTCCGCGTGCTACTTCTCGAGAAGTAGCACGCGGAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000490
AVP MISSION shRNA Lentiviral Transduction Particles
arginine vasopressin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-903s1c1
Sequence:CCGGCAGCATCTGCTGCGCGGACGACTCGAGTCGTCCGCGCAGCAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-822s1c1
Sequence:CCGGCGGCAAGAGGGCCATGTCCGACTCGAGTCGGACATGGCCCTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-765s1c1
Sequence:CCGGCTTCCTCGGCCTACTGGCCTTCTCGAGAAGGCCAGTAGGCCGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000490.2-1035s1c1
Sequence:CCGGCGCCTTCGGCGTTTGCTGCAACTCGAGTTGCAGCAAACGCCGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-273s21c1
Sequence:CCGGTGCCAGGAGGAGAACTACCTGCTCGAGCAGGTAGTTCTCCTCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-147s21c1
Sequence:CCGGATGTCCGACCTGGAGCTGAGACTCGAGTCTCAGCTCCAGGTCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-110s21c1
Sequence:CCGGCTACTTCCAGAACTGCCCGAGCTCGAGCTCGGGCAGTTCTGGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000490.4-95s21c1
Sequence:CCGGCTTCTCCTCCGCGTGCTACTTCTCGAGAAGTAGCACGCGGAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009732
AVP MISSION shRNA Bacterial Glycerol Stock
arginine vasopressin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-26s21c1
Sequence:CCGGCGCTCTCCGCTTGTTTCCTGACTCGAGTCAGGAAACAAGCGGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-99s21c1
Sequence:CCGGCAAGAGGGCCATCTCTGACATCTCGAGATGTCAGAGATGGCCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-57s21c1
Sequence:CCGGCTTCTCCTCCGCCTGCTACTTCTCGAGAAGTAGCAGGCGGAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-112s21c1
Sequence:CCGGTCTGACATGGAGCTGAGACAGCTCGAGCTGTCTCAGCTCCATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-73s21c1
Sequence:CCGGTACTTCCAGAACTGCCCAAGACTCGAGTCTTGGGCAGTTCTGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009732
AVP MISSION shRNA shRNA Plasmid DNA
arginine vasopressin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-26s21c1
Sequence:CCGGCGCTCTCCGCTTGTTTCCTGACTCGAGTCAGGAAACAAGCGGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-99s21c1
Sequence:CCGGCAAGAGGGCCATCTCTGACATCTCGAGATGTCAGAGATGGCCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-57s21c1
Sequence:CCGGCTTCTCCTCCGCCTGCTACTTCTCGAGAAGTAGCAGGCGGAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-112s21c1
Sequence:CCGGTCTGACATGGAGCTGAGACAGCTCGAGCTGTCTCAGCTCCATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-73s21c1
Sequence:CCGGTACTTCCAGAACTGCCCAAGACTCGAGTCTTGGGCAGTTCTGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009732
AVP MISSION shRNA Lentiviral Transduction Particles
arginine vasopressin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-26s21c1
Sequence:CCGGCGCTCTCCGCTTGTTTCCTGACTCGAGTCAGGAAACAAGCGGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-99s21c1
Sequence:CCGGCAAGAGGGCCATCTCTGACATCTCGAGATGTCAGAGATGGCCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-57s21c1
Sequence:CCGGCTTCTCCTCCGCCTGCTACTTCTCGAGAAGTAGCAGGCGGAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-112s21c1
Sequence:CCGGTCTGACATGGAGCTGAGACAGCTCGAGCTGTCTCAGCTCCATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009732.1-73s21c1
Sequence:CCGGTACTTCCAGAACTGCCCAAGACTCGAGTCTTGGGCAGTTCTGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks