EMAIL THIS PAGE TO A FRIEND

AVPI1

arginine vasopressin-induced 1

49 Gene Product Result for
Synonyms: PP5395 RP11-548K23.7 VIP32 VIT32
UniProtKB ID: Q5T686, Q53G32, Q9H2R9, Q9HBN9
Gene ID:
Mouse(69534) arginine vasopressin-induced 1
Rat(171386) arginine vasopressin-induced 1
domestic cat(101080664) arginine vasopressin-induced 1
cow(614488) arginine vasopressin-induced 1
dog(608786) arginine vasopressin-induced 1
naked mole-rat(101702020) arginine vasopressin-induced 1
domestic guinea pig(100721579) arginine vasopressin-induced 1
sheep(101115666) arginine vasopressin-induced 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
V1880 [deamino-Pen1, O-Me-Tyr2, Arg8]-Vasopressin ≥97% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021732 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021732 Rosetta Predictions human pricing
NM_134373 Rosetta Predictions rat pricing
NM_027106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195653 predicted 1065
2 SASI_Hs01_00195654 predicted 925
3 SASI_Hs01_00195655 predicted 1031
4 SASI_Hs01_00195656 predicted 618
5 SASI_Hs01_00195657 predicted 881
6 SASI_Hs01_00195659 predicted 630
7 SASI_Hs01_00195660 predicted 1056
8 SASI_Hs02_00355058 predicted 928
9 SASI_Hs01_00195661 predicted 886
10 SASI_Hs01_00195662 predicted 896
11 SASI_Hs01_00195658 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061806 predicted 649
2 SASI_Rn01_00061807 predicted 599
3 SASI_Rn01_00061808 predicted 417
4 SASI_Rn01_00061809 predicted 604
5 SASI_Rn01_00061810 predicted 622
6 SASI_Rn01_00061811 predicted 493
7 SASI_Rn02_00267937 predicted 468
8 SASI_Rn01_00061812 predicted 563
9 SASI_Rn01_00061813 predicted 568
10 SASI_Rn01_00061814 predicted 644
11 SASI_Rn01_00061815 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061416 predicted 530
2 SASI_Mm01_00061417 predicted 593
3 SASI_Mm01_00061418 predicted 607
4 SASI_Mm01_00061420 predicted 670
5 SASI_Mm02_00331544 predicted 285
6 SASI_Mm01_00061421 predicted 600
7 SASI_Mm01_00061422 predicted 655
8 SASI_Mm01_00061423 predicted 658
9 SASI_Mm01_00061424 predicted 737
10 SASI_Mm01_00061425 predicted 604
11 SASI_Mm01_00061419 predicted 725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021732
VALIDATED
AVPI1 MISSION shRNA Bacterial Glycerol Stock
arginine vasopressin-induced 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021732.2-678s21c1
Sequence:CCGGGCACAGATCATCTGGGAATGTCTCGAGACATTCCCAGATGATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021732.2-1248s21c1
Sequence:CCGGCAGGCACTTAGATGCAGCATTCTCGAGAATGCTGCATCTAAGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_021732.2-1237s21c1
Sequence:CCGGGAGCAAAGTGACAGGCACTTACTCGAGTAAGTGCCTGTCACTTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021732.2-1113s21c1
Sequence:CCGGGCTTCTGTTGAGCTCTCCATTCTCGAGAATGGAGAGCTCAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021732.2-1092s21c1
Sequence:CCGGCCATTCAGAACAAGACTGGATCTCGAGATCCAGTCTTGTTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1203s1c1
Sequence:CCGGCAGGCACTTAGATGCAGCATTCTCGAGAATGCTGCATCTAAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1047s1c1
Sequence:CCGGCCATTCAGAACAAGACTGGATCTCGAGATCCAGTCTTGTTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1192s1c1
Sequence:CCGGGAGCAAAGTGACAGGCACTTACTCGAGTAAGTGCCTGTCACTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1068s1c1
Sequence:CCGGGCTTCTGTTGAGCTCTCCATTCTCGAGAATGGAGAGCTCAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021732.1-821s1c1
Sequence:CCGGGCAGTATCTGCACTCTAGGAACTCGAGTTCCTAGAGTGCAGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021732.1-636s1c1
Sequence:CCGGCAGATCATCTGGGAATGTGCACTCGAGTGCACATTCCCAGATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021732.1-969s1c1
Sequence:CCGGGAGGTGAAGGAAGAGAGACTTCTCGAGAAGTCTCTCTTCCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-633s1c1
Sequence:CCGGGCACAGATCATCTGGGAATGTCTCGAGACATTCCCAGATGATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021732
VALIDATED
AVPI1 MISSION shRNA shRNA Plasmid DNA
arginine vasopressin-induced 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021732.2-678s21c1
Sequence:CCGGGCACAGATCATCTGGGAATGTCTCGAGACATTCCCAGATGATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021732.2-1248s21c1
Sequence:CCGGCAGGCACTTAGATGCAGCATTCTCGAGAATGCTGCATCTAAGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_021732.2-1237s21c1
Sequence:CCGGGAGCAAAGTGACAGGCACTTACTCGAGTAAGTGCCTGTCACTTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021732.2-1113s21c1
Sequence:CCGGGCTTCTGTTGAGCTCTCCATTCTCGAGAATGGAGAGCTCAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021732.2-1092s21c1
Sequence:CCGGCCATTCAGAACAAGACTGGATCTCGAGATCCAGTCTTGTTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1203s1c1
Sequence:CCGGCAGGCACTTAGATGCAGCATTCTCGAGAATGCTGCATCTAAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1047s1c1
Sequence:CCGGCCATTCAGAACAAGACTGGATCTCGAGATCCAGTCTTGTTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1192s1c1
Sequence:CCGGGAGCAAAGTGACAGGCACTTACTCGAGTAAGTGCCTGTCACTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1068s1c1
Sequence:CCGGGCTTCTGTTGAGCTCTCCATTCTCGAGAATGGAGAGCTCAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021732.1-821s1c1
Sequence:CCGGGCAGTATCTGCACTCTAGGAACTCGAGTTCCTAGAGTGCAGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021732.1-636s1c1
Sequence:CCGGCAGATCATCTGGGAATGTGCACTCGAGTGCACATTCCCAGATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021732.1-969s1c1
Sequence:CCGGGAGGTGAAGGAAGAGAGACTTCTCGAGAAGTCTCTCTTCCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-633s1c1
Sequence:CCGGGCACAGATCATCTGGGAATGTCTCGAGACATTCCCAGATGATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021732
VALIDATED
AVPI1 MISSION shRNA Lentiviral Transduction Particles
arginine vasopressin-induced 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021732.2-678s21c1
Sequence:CCGGGCACAGATCATCTGGGAATGTCTCGAGACATTCCCAGATGATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021732.2-1248s21c1
Sequence:CCGGCAGGCACTTAGATGCAGCATTCTCGAGAATGCTGCATCTAAGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_021732.2-1237s21c1
Sequence:CCGGGAGCAAAGTGACAGGCACTTACTCGAGTAAGTGCCTGTCACTTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021732.2-1113s21c1
Sequence:CCGGGCTTCTGTTGAGCTCTCCATTCTCGAGAATGGAGAGCTCAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021732.2-1092s21c1
Sequence:CCGGCCATTCAGAACAAGACTGGATCTCGAGATCCAGTCTTGTTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1203s1c1
Sequence:CCGGCAGGCACTTAGATGCAGCATTCTCGAGAATGCTGCATCTAAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1047s1c1
Sequence:CCGGCCATTCAGAACAAGACTGGATCTCGAGATCCAGTCTTGTTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1192s1c1
Sequence:CCGGGAGCAAAGTGACAGGCACTTACTCGAGTAAGTGCCTGTCACTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-1068s1c1
Sequence:CCGGGCTTCTGTTGAGCTCTCCATTCTCGAGAATGGAGAGCTCAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021732.1-821s1c1
Sequence:CCGGGCAGTATCTGCACTCTAGGAACTCGAGTTCCTAGAGTGCAGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021732.1-636s1c1
Sequence:CCGGCAGATCATCTGGGAATGTGCACTCGAGTGCACATTCCCAGATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021732.1-969s1c1
Sequence:CCGGGAGGTGAAGGAAGAGAGACTTCTCGAGAAGTCTCTCTTCCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021732.1-633s1c1
Sequence:CCGGGCACAGATCATCTGGGAATGTCTCGAGACATTCCCAGATGATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027106
VALIDATED
AVPI1 MISSION shRNA Bacterial Glycerol Stock
arginine vasopressin-induced 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027106.1-677s1c1
Sequence:CCGGGTAATTGGAATGCCCTGAGTTCTCGAGAACTCAGGGCATTCCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027106.1-662s1c1
Sequence:CCGGGTGAAGAAGAAAGTGGTAATTCTCGAGAATTACCACTTTCTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027106.1-653s1c1
Sequence:CCGGCCTGTGTAGGTGAAGAAGAAACTCGAGTTTCTTCTTCACCTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027106.1-775s1c1
Sequence:CCGGCATCAGCCTTTCTGACCTAAACTCGAGTTTAGGTCAGAAAGGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027106.1-612s1c1
Sequence:CCGGCAAAGGGCTTATGGAGTTGTACTCGAGTACAACTCCATAAGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027106
VALIDATED
AVPI1 MISSION shRNA shRNA Plasmid DNA
arginine vasopressin-induced 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027106.1-677s1c1
Sequence:CCGGGTAATTGGAATGCCCTGAGTTCTCGAGAACTCAGGGCATTCCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027106.1-662s1c1
Sequence:CCGGGTGAAGAAGAAAGTGGTAATTCTCGAGAATTACCACTTTCTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027106.1-653s1c1
Sequence:CCGGCCTGTGTAGGTGAAGAAGAAACTCGAGTTTCTTCTTCACCTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027106.1-775s1c1
Sequence:CCGGCATCAGCCTTTCTGACCTAAACTCGAGTTTAGGTCAGAAAGGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027106.1-612s1c1
Sequence:CCGGCAAAGGGCTTATGGAGTTGTACTCGAGTACAACTCCATAAGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027106
VALIDATED
AVPI1 MISSION shRNA Lentiviral Transduction Particles
arginine vasopressin-induced 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027106.1-677s1c1
Sequence:CCGGGTAATTGGAATGCCCTGAGTTCTCGAGAACTCAGGGCATTCCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027106.1-662s1c1
Sequence:CCGGGTGAAGAAGAAAGTGGTAATTCTCGAGAATTACCACTTTCTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027106.1-653s1c1
Sequence:CCGGCCTGTGTAGGTGAAGAAGAAACTCGAGTTTCTTCTTCACCTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027106.1-775s1c1
Sequence:CCGGCATCAGCCTTTCTGACCTAAACTCGAGTTTAGGTCAGAAAGGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027106.1-612s1c1
Sequence:CCGGCAAAGGGCTTATGGAGTTGTACTCGAGTACAACTCCATAAGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks