EMAIL THIS PAGE TO A FRIEND

AVPR1A

arginine vasopressin receptor 1A

61 Gene Product Result for
Synonyms: AVPR V1a AVPR1 V1aR
UniProtKB ID: P37288
Gene ID:
Human(552) Summary: The protein encoded by this gene acts as receptor for arginine vasopressin. This receptor belongs to the subfamily of G-protein coupled receptors which includes AVPR1B, V2R and OXT receptors. Its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. The receptor mediates cell contraction and proliferation, platelet aggregation, release of coagulation factor and glycogenolysis. [provided by RefSeq, Jul 2008]
Mouse(54140) arginine vasopressin receptor 1A
Rat(25107) arginine vasopressin receptor 1A
sheep(100528010) arginine vasopressin receptor 1A
Domestic Rabbit(100345154) arginine vasopressin receptor 1A
domestic guinea pig(100733909) arginine vasopressin receptor 1A
naked mole-rat(101717487) arginine vasopressin receptor 1A
chicken(771773) arginine vasopressin receptor 1A
cow(538439) arginine vasopressin receptor 1A
domestic cat(101100229) arginine vasopressin receptor 1A
Horse(100056176) arginine vasopressin receptor 1A
dog(481142) arginine vasopressin receptor 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000706 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000706 Rosetta Predictions human pricing
NM_053019 Rosetta Predictions rat pricing
NM_016847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078910 predicted 3001
2 SASI_Hs01_00078911 predicted 3245
3 SASI_Hs01_00078912 predicted 3310
4 SASI_Hs01_00078913 predicted 3150
5 SASI_Hs01_00078914 predicted 3288
6 SASI_Hs01_00078915 predicted 3101
7 SASI_Hs01_00078916 predicted 2521
8 SASI_Hs01_00078917 predicted 3289
9 SASI_Hs01_00078918 predicted 3183
10 SASI_Hs02_00303109 predicted 3194
11 SASI_Hs01_00078919 predicted 2373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087101 predicted 648
2 SASI_Rn01_00087104 predicted 637
3 SASI_Rn01_00087105 predicted 499
4 SASI_Rn01_00087106 predicted 629
5 SASI_Rn01_00087107 predicted 632
6 SASI_Rn02_00265636 predicted 1112
7 SASI_Rn01_00087108 predicted 740
8 SASI_Rn02_00265637 predicted 956
9 SASI_Rn01_00087110 predicted 560
10 SASI_Rn02_00265638 predicted 778
11 SASI_Rn01_00087102 predicted 381
12 SASI_Rn01_00087103 predicted 376
13 SASI_Rn01_00087109 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042385 predicted 1524
2 SASI_Mm01_00042386 predicted 1647
3 SASI_Mm01_00042387 predicted 1526
4 SASI_Mm01_00042388 predicted 831
5 SASI_Mm01_00042390 predicted 545
6 SASI_Mm01_00042391 predicted 713
7 SASI_Mm01_00042392 predicted 694
8 SASI_Mm01_00042393 predicted 842
9 SASI_Mm01_00042394 predicted 1271
10 SASI_Mm02_00323625 predicted 1275
11 SASI_Mm01_00042389 predicted 1659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000706
AVPR1A MISSION shRNA Bacterial Glycerol Stock
arginine vasopressin receptor 1A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000706.3-3461s1c1
Sequence:CCGGCCAGAAATACAACAGAAGTTACTCGAGTAACTTCTGTTGTATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-2966s1c1
Sequence:CCGGCCATCACTGCATTACTGGGTTCTCGAGAACCCAGTAATGCAGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-2996s1c1
Sequence:CCGGGCTGCTGTAATCCCTGGATATCTCGAGATATCCAGGGATTACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-3153s1c1
Sequence:CCGGCCCAACAAACAGTACGGGTATCTCGAGATACCCGTACTGTTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-3203s1c1
Sequence:CCGGCCATCAAATTCATTCCTGTTTCTCGAGAAACAGGAATGAATTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000706.3-3173s21c1
Sequence:CCGGTGTGGAAGGACTCGCCTAAATCTCGAGATTTAGGCGAGTCCTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000706.3-2801s21c1
Sequence:CCGGTCAGCAGCGTGAAGTCCATTTCTCGAGAAATGGACTTCACGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000706.3-3500s21c1
Sequence:CCGGCATAACCACCCTAGCTTTATACTCGAGTATAAAGCTAGGGTGGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000706.3-3616s21c1
Sequence:CCGGAGAGCTCATCATCAGTCTTAACTCGAGTTAAGACTGATGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000706
AVPR1A MISSION shRNA shRNA Plasmid DNA
arginine vasopressin receptor 1A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000706.3-3461s1c1
Sequence:CCGGCCAGAAATACAACAGAAGTTACTCGAGTAACTTCTGTTGTATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-2966s1c1
Sequence:CCGGCCATCACTGCATTACTGGGTTCTCGAGAACCCAGTAATGCAGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-2996s1c1
Sequence:CCGGGCTGCTGTAATCCCTGGATATCTCGAGATATCCAGGGATTACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-3153s1c1
Sequence:CCGGCCCAACAAACAGTACGGGTATCTCGAGATACCCGTACTGTTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-3203s1c1
Sequence:CCGGCCATCAAATTCATTCCTGTTTCTCGAGAAACAGGAATGAATTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000706.3-3173s21c1
Sequence:CCGGTGTGGAAGGACTCGCCTAAATCTCGAGATTTAGGCGAGTCCTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000706.3-2801s21c1
Sequence:CCGGTCAGCAGCGTGAAGTCCATTTCTCGAGAAATGGACTTCACGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000706.3-3500s21c1
Sequence:CCGGCATAACCACCCTAGCTTTATACTCGAGTATAAAGCTAGGGTGGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000706.3-3616s21c1
Sequence:CCGGAGAGCTCATCATCAGTCTTAACTCGAGTTAAGACTGATGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000706
AVPR1A MISSION shRNA Lentiviral Transduction Particles
arginine vasopressin receptor 1A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000706.3-3461s1c1
Sequence:CCGGCCAGAAATACAACAGAAGTTACTCGAGTAACTTCTGTTGTATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-2966s1c1
Sequence:CCGGCCATCACTGCATTACTGGGTTCTCGAGAACCCAGTAATGCAGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-2996s1c1
Sequence:CCGGGCTGCTGTAATCCCTGGATATCTCGAGATATCCAGGGATTACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-3153s1c1
Sequence:CCGGCCCAACAAACAGTACGGGTATCTCGAGATACCCGTACTGTTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000706.3-3203s1c1
Sequence:CCGGCCATCAAATTCATTCCTGTTTCTCGAGAAACAGGAATGAATTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000706.3-3173s21c1
Sequence:CCGGTGTGGAAGGACTCGCCTAAATCTCGAGATTTAGGCGAGTCCTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000706.3-2801s21c1
Sequence:CCGGTCAGCAGCGTGAAGTCCATTTCTCGAGAAATGGACTTCACGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000706.3-3500s21c1
Sequence:CCGGCATAACCACCCTAGCTTTATACTCGAGTATAAAGCTAGGGTGGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000706.3-3616s21c1
Sequence:CCGGAGAGCTCATCATCAGTCTTAACTCGAGTTAAGACTGATGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016847
VALIDATED
AVPR1A MISSION shRNA Bacterial Glycerol Stock
arginine vasopressin receptor 1A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-604s1c1
Sequence:CCGGGTCGCCTTCTTCCAAGTGTTACTCGAGTAACACTTGGAAGAAGGCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-2185s1c1
Sequence:CCGGCCACACTTTATAGAGGCATAACTCGAGTTATGCCTCTATAAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-1520s1c1
Sequence:CCGGCGTGGAAGGATTCACCTAAATCTCGAGATTTAGGTGAATCCTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-1274s1c1
Sequence:CCGGCCAATTTCGTTTGGACCGATTCTCGAGAATCGGTCCAAACGAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016847.2-835s1c1
Sequence:CCGGCTGAGTTTCGTTCTGAGCATACTCGAGTATGCTCAGAACGAAACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-1840s21c1
Sequence:CCGGTTCGTAAGCATACTGACTTTACTCGAGTAAAGTCAGTATGCTTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-470s21c1
Sequence:CCGGTTACCGTGCTGGCGGTGATTTCTCGAGAAATCACCGCCAGCACGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-604s21c1
Sequence:CCGGGTCGCCTTCTTCCAAGTGTTACTCGAGTAACACTTGGAAGAAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-1274s21c1
Sequence:CCGGCCAATTTCGTTTGGACCGATTCTCGAGAATCGGTCCAAACGAAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016847.2-868s21c1
Sequence:CCGGATCTTCTCTGTGATCGAATTTCTCGAGAAATTCGATCACAGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016847
VALIDATED
AVPR1A MISSION shRNA shRNA Plasmid DNA
arginine vasopressin receptor 1A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-604s1c1
Sequence:CCGGGTCGCCTTCTTCCAAGTGTTACTCGAGTAACACTTGGAAGAAGGCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-2185s1c1
Sequence:CCGGCCACACTTTATAGAGGCATAACTCGAGTTATGCCTCTATAAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-1520s1c1
Sequence:CCGGCGTGGAAGGATTCACCTAAATCTCGAGATTTAGGTGAATCCTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-1274s1c1
Sequence:CCGGCCAATTTCGTTTGGACCGATTCTCGAGAATCGGTCCAAACGAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016847.2-835s1c1
Sequence:CCGGCTGAGTTTCGTTCTGAGCATACTCGAGTATGCTCAGAACGAAACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-1840s21c1
Sequence:CCGGTTCGTAAGCATACTGACTTTACTCGAGTAAAGTCAGTATGCTTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-470s21c1
Sequence:CCGGTTACCGTGCTGGCGGTGATTTCTCGAGAAATCACCGCCAGCACGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-604s21c1
Sequence:CCGGGTCGCCTTCTTCCAAGTGTTACTCGAGTAACACTTGGAAGAAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-1274s21c1
Sequence:CCGGCCAATTTCGTTTGGACCGATTCTCGAGAATCGGTCCAAACGAAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016847.2-868s21c1
Sequence:CCGGATCTTCTCTGTGATCGAATTTCTCGAGAAATTCGATCACAGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016847
VALIDATED
AVPR1A MISSION shRNA Lentiviral Transduction Particles
arginine vasopressin receptor 1A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-604s1c1
Sequence:CCGGGTCGCCTTCTTCCAAGTGTTACTCGAGTAACACTTGGAAGAAGGCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-2185s1c1
Sequence:CCGGCCACACTTTATAGAGGCATAACTCGAGTTATGCCTCTATAAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-1520s1c1
Sequence:CCGGCGTGGAAGGATTCACCTAAATCTCGAGATTTAGGTGAATCCTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016847.2-1274s1c1
Sequence:CCGGCCAATTTCGTTTGGACCGATTCTCGAGAATCGGTCCAAACGAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016847.2-835s1c1
Sequence:CCGGCTGAGTTTCGTTCTGAGCATACTCGAGTATGCTCAGAACGAAACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-1840s21c1
Sequence:CCGGTTCGTAAGCATACTGACTTTACTCGAGTAAAGTCAGTATGCTTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-470s21c1
Sequence:CCGGTTACCGTGCTGGCGGTGATTTCTCGAGAAATCACCGCCAGCACGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-604s21c1
Sequence:CCGGGTCGCCTTCTTCCAAGTGTTACTCGAGTAACACTTGGAAGAAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016847.2-1274s21c1
Sequence:CCGGCCAATTTCGTTTGGACCGATTCTCGAGAATCGGTCCAAACGAAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016847.2-868s21c1
Sequence:CCGGATCTTCTCTGTGATCGAATTTCTCGAGAAATTCGATCACAGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks